5039 lines
207 KiB
Plaintext
5039 lines
207 KiB
Plaintext
\input texinfo @c -*-texinfo-*-
|
|
@c %**start of header (This is for running Texinfo on a region.)
|
|
@setfilename gawkinet.info
|
|
@settitle TCP/IP Internetworking With @command{gawk}
|
|
@c %**end of header (This is for running Texinfo on a region.)
|
|
@c FIXME: web vs. Web
|
|
@c Correct spelling of web is still under discussion.
|
|
@c https://english.stackexchange.com/questions/120869/should-i-capitalize-the-word-web-in-this-sentence
|
|
@c We leave the many occurrences of web in this file as they are.
|
|
|
|
@dircategory Network applications
|
|
@direntry
|
|
* awkinet: (gawkinet). TCP/IP Internetworking With `gawk'.
|
|
@end direntry
|
|
|
|
@iftex
|
|
@set DOCUMENT book
|
|
@set CHAPTER chapter
|
|
@set SECTION section
|
|
@set DARKCORNER @inmargin{@image{lflashlight,1cm}, @image{rflashlight,1cm}}
|
|
@end iftex
|
|
@ifinfo
|
|
@set DOCUMENT Info file
|
|
@set CHAPTER major node
|
|
@set SECTION node
|
|
@set DARKCORNER (d.c.)
|
|
@end ifinfo
|
|
@ifhtml
|
|
@set DOCUMENT web page
|
|
@set CHAPTER chapter
|
|
@set SECTION section
|
|
@set DARKCORNER (d.c.)
|
|
@end ifhtml
|
|
|
|
@set FSF
|
|
|
|
@set FN file name
|
|
@set FFN File Name
|
|
|
|
@c merge the function and variable indexes into the concept index
|
|
@ifinfo
|
|
@synindex fn cp
|
|
@synindex vr cp
|
|
@end ifinfo
|
|
@iftex
|
|
@syncodeindex fn cp
|
|
@syncodeindex vr cp
|
|
@end iftex
|
|
|
|
@c If "finalout" is commented out, the printed output will show
|
|
@c black boxes that mark lines that are too long. Thus, it is
|
|
@c unwise to comment it out when running a master in case there are
|
|
@c overfulls which are deemed okay.
|
|
|
|
@iftex
|
|
@finalout
|
|
@end iftex
|
|
|
|
@smallbook
|
|
|
|
@c Special files are described in chapter 6 Printing Output under
|
|
@c 6.7 Special File Names in gawk. I think the networking does not
|
|
@c fit into that chapter, thus this separate document. At over 50
|
|
@c pages, I think this is the right decision. ADR.
|
|
|
|
@set TITLE TCP/IP Internetworking with @command{gawk}
|
|
@set EDITION 1.6
|
|
@set UPDATE-MONTH October, 2021
|
|
@c gawk versions:
|
|
@set VERSION 5.2
|
|
@set PATCHLEVEL 0
|
|
|
|
@copying
|
|
This is Edition @value{EDITION} of @cite{@value{TITLE}},
|
|
for the @value{VERSION}.@value{PATCHLEVEL} (or later) version of the GNU
|
|
implementation of AWK.
|
|
@sp 2
|
|
Copyright (C) 2000, 2001, 2002, 2004, 2009, 2010, 2016, 2019, 2020, 2021
|
|
Free Software Foundation, Inc.
|
|
@sp 2
|
|
Permission is granted to copy, distribute and/or modify this document
|
|
under the terms of the GNU Free Documentation License, Version 1.3 or
|
|
any later version published by the Free Software Foundation; with the
|
|
Invariant Sections being ``GNU General Public License'', the Front-Cover
|
|
texts being (a) (see below), and with the Back-Cover Texts being (b)
|
|
(see below). A copy of the license is included in the section entitled
|
|
``GNU Free Documentation License''.
|
|
|
|
@enumerate a
|
|
@item
|
|
``A GNU Manual''
|
|
|
|
@item
|
|
``You have the freedom to
|
|
copy and modify this GNU manual. Buying copies from the FSF
|
|
supports it in developing GNU and promoting software freedom.''
|
|
@end enumerate
|
|
@end copying
|
|
|
|
@setchapternewpage odd
|
|
|
|
@titlepage
|
|
@title @value{TITLE}
|
|
@subtitle Edition @value{EDITION}
|
|
@subtitle @value{UPDATE-MONTH}
|
|
@author J@"urgen Kahrs
|
|
@author with Arnold D. Robbins
|
|
|
|
@c Include the Distribution inside the titlepage environment so
|
|
@c that headings are turned off. Headings on and off do not work.
|
|
|
|
@page
|
|
@vskip 0pt plus 1filll
|
|
@sp 2
|
|
Published by:
|
|
@sp 1
|
|
|
|
Free Software Foundation @*
|
|
51 Franklin Street, Fifth Floor @*
|
|
Boston, MA 02110-1301 USA @*
|
|
Phone: +1-617-542-5942 @*
|
|
Fax: +1-617-542-2652 @*
|
|
Email: @email{gnu@@gnu.org} @*
|
|
URL: @uref{http://www.gnu.org/} @*
|
|
|
|
ISBN 1-882114-93-0 @*
|
|
|
|
@insertcopying
|
|
|
|
@c @sp 2
|
|
@c Cover art by ?????.
|
|
@end titlepage
|
|
|
|
@iftex
|
|
@headings off
|
|
@evenheading @thispage@ @ @ @strong{@value{TITLE}} @| @|
|
|
@oddheading @| @| @strong{@thischapter}@ @ @ @thispage
|
|
@end iftex
|
|
|
|
@ifnottex
|
|
@node Top, Preface, (dir), (dir)
|
|
@top General Introduction
|
|
@comment node-name, next, previous, up
|
|
|
|
This file documents the networking features in GNU Awk (@command{gawk})
|
|
version 4.0 and later.
|
|
|
|
@insertcopying
|
|
@end ifnottex
|
|
|
|
@menu
|
|
* Preface:: About this document.
|
|
* Introduction:: About networking.
|
|
* Using Networking:: Some examples.
|
|
* Some Applications and Techniques:: More extended examples.
|
|
* Links:: Where to find the stuff mentioned in this
|
|
document.
|
|
* GNU Free Documentation License:: The license for this document.
|
|
* Index:: The index.
|
|
|
|
@detailmenu
|
|
* Stream Communications:: Sending data streams.
|
|
* Datagram Communications:: Sending self-contained messages.
|
|
* The TCP/IP Protocols:: How these models work in the Internet.
|
|
* Basic Protocols:: The basic protocols.
|
|
* Ports:: The idea behind ports.
|
|
* Making Connections:: Making TCP/IP connections.
|
|
* Gawk Special Files:: How to do @command{gawk} networking.
|
|
* Special File Fields:: The fields in the special file name.
|
|
* Comparing Protocols:: Differences between the protocols.
|
|
* File /inet/tcp:: The TCP special file.
|
|
* File /inet/udp:: The UDP special file.
|
|
* TCP Connecting:: Making a TCP connection.
|
|
* Troubleshooting:: Troubleshooting TCP/IP connections.
|
|
* Interacting:: Interacting with a service.
|
|
* Setting Up:: Setting up a service.
|
|
* Email:: Reading email.
|
|
* Web page:: Reading a Web page.
|
|
* Primitive Service:: A primitive Web service.
|
|
* Interacting Service:: A Web service with interaction.
|
|
* CGI Lib:: A simple CGI library.
|
|
* Simple Server:: A simple Web server.
|
|
* Caveats:: Network programming caveats.
|
|
* Challenges:: Where to go from here.
|
|
* PANIC:: An Emergency Web Server.
|
|
* GETURL:: Retrieving Web Pages.
|
|
* REMCONF:: Remote Configuration Of Embedded Systems.
|
|
* URLCHK:: Look For Changed Web Pages.
|
|
* WEBGRAB:: Extract Links From A Page.
|
|
* STATIST:: Graphing A Statistical Distribution.
|
|
* MAZE:: Walking Through A Maze In Virtual Reality.
|
|
* MOBAGWHO:: A Simple Mobile Agent.
|
|
* STOXPRED:: Stock Market Prediction As A Service.
|
|
* PROTBASE:: Searching Through A Protein Database.
|
|
@end detailmenu
|
|
@end menu
|
|
|
|
@contents
|
|
|
|
@node Preface, Introduction, Top, Top
|
|
@unnumbered Preface
|
|
|
|
In May of 1997, J@"urgen Kahrs felt the need for network access
|
|
from @command{awk}, and, with a little help from me, set about adding
|
|
features to do this for @command{gawk}. At that time, he
|
|
wrote the bulk of this @value{DOCUMENT}.
|
|
|
|
The code and documentation were added to the @command{gawk} 3.1 development
|
|
tree, and languished somewhat until I could finally get
|
|
down to some serious work on that version of @command{gawk}.
|
|
This finally happened in the middle of 2000.
|
|
|
|
Meantime, J@"urgen wrote an article about the Internet special
|
|
files and @samp{|&} operator for @cite{Linux Journal}, and made a
|
|
networking patch for the production versions of @command{gawk}
|
|
available from his home page.
|
|
In August of 2000 (for @command{gawk} 3.0.6), this patch
|
|
also made it to the main GNU @command{ftp} distribution site.
|
|
|
|
For release with @command{gawk}, I edited J@"urgen's prose
|
|
for English grammar and style, as he is not a native English
|
|
speaker. I also
|
|
rearranged the material somewhat for what I felt was a better order of
|
|
presentation, and (re)wrote some of the introductory material.
|
|
|
|
The majority of this document and the code are his work, and the
|
|
high quality and interesting ideas speak for themselves. It is my
|
|
hope that these features will be of significant value to the @command{awk}
|
|
community.
|
|
|
|
@sp 1
|
|
@noindent
|
|
Arnold Robbins @*
|
|
Nof Ayalon, ISRAEL @*
|
|
March, 2001
|
|
|
|
@c system if test ! -d eg ; then mkdir eg ; fi
|
|
@c system if test ! -d eg/network ; then mkdir eg/network ; fi
|
|
@node Introduction, Using Networking, Preface, Top
|
|
@chapter Networking Concepts
|
|
|
|
This @value{CHAPTER} provides a (necessarily) brief introduction to
|
|
computer networking concepts. For many applications of @command{gawk}
|
|
to TCP/IP networking, we hope that this is enough. For more
|
|
advanced tasks, you will need deeper background, and it may be necessary
|
|
to switch to lower-level programming in C or C++.
|
|
|
|
There are two real-life models for the way computers send messages
|
|
to each other over a network. While the analogies are not perfect,
|
|
they are close enough to convey the major concepts.
|
|
These two models are the phone system (reliable byte-stream communications),
|
|
and the postal system (best-effort datagrams).
|
|
|
|
@menu
|
|
* Stream Communications:: Sending data streams.
|
|
* Datagram Communications:: Sending self-contained messages.
|
|
* The TCP/IP Protocols:: How these models work in the Internet.
|
|
* Making Connections:: Making TCP/IP connections.
|
|
@end menu
|
|
|
|
@node Stream Communications, Datagram Communications, Introduction, Introduction
|
|
@section Reliable Byte-streams (Phone Calls)
|
|
|
|
When you make a phone call, the following steps occur:
|
|
|
|
@enumerate
|
|
@item
|
|
You dial a number.
|
|
|
|
@item
|
|
The phone system connects to the called party, telling
|
|
them there is an incoming call. (Their phone rings.)
|
|
|
|
@item
|
|
The other party answers the call, or, in the case of a
|
|
computer network, refuses to answer the call.
|
|
|
|
@item
|
|
Assuming the other party answers, the connection between
|
|
you is now a @dfn{duplex} (two-way), @dfn{reliable} (no data lost),
|
|
sequenced (data comes out in the order sent) data stream.
|
|
|
|
@item
|
|
You and your friend may now talk freely, with the phone system
|
|
moving the data (your voices) from one end to the other.
|
|
From your point of view, you have a direct end-to-end
|
|
connection with the person on the other end.
|
|
@end enumerate
|
|
|
|
The same steps occur in a duplex reliable computer networking connection.
|
|
There is considerably more overhead in setting up the communications,
|
|
but once it's done, data moves in both directions, reliably, in sequence.
|
|
|
|
@node Datagram Communications, The TCP/IP Protocols, Stream Communications, Introduction
|
|
@section Best-effort Datagrams (Mailed Letters)
|
|
|
|
Suppose you mail three different documents to your office on the
|
|
other side of the country on two different days. Doing so
|
|
entails the following.
|
|
|
|
@enumerate
|
|
@item
|
|
Each document travels in its own envelope.
|
|
|
|
@item
|
|
Each envelope contains both the sender and the
|
|
recipient address.
|
|
|
|
@item
|
|
Each envelope may travel a different route to its destination.
|
|
|
|
@item
|
|
The envelopes may arrive in a different order from the one
|
|
in which they were sent.
|
|
|
|
@item
|
|
One or more may get lost in the mail.
|
|
(Although, fortunately, this does not occur very often.)
|
|
|
|
@item
|
|
In a computer network, one or more @dfn{packets}
|
|
may also arrive multiple times. (This doesn't happen
|
|
with the postal system!)
|
|
|
|
@end enumerate
|
|
|
|
The important characteristics of datagram communications, like
|
|
those of the postal system are thus:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
Delivery is ``best effort;'' the data may never get there.
|
|
|
|
@item
|
|
Each message is self-contained, including the source and
|
|
destination addresses.
|
|
|
|
@item
|
|
Delivery is @emph{not} sequenced; packets may arrive out
|
|
of order, and/or multiple times.
|
|
|
|
@item
|
|
Unlike the phone system, overhead is considerably lower.
|
|
It is not necessary to set up the call first.
|
|
@end itemize
|
|
|
|
The price the user pays for the lower overhead of datagram communications
|
|
is exactly the lower reliability; it is often necessary for user-level
|
|
protocols that use datagram communications to add their own reliability
|
|
features on top of the basic communications.
|
|
|
|
@node The TCP/IP Protocols, Making Connections, Datagram Communications, Introduction
|
|
@section The Internet Protocols
|
|
|
|
The Internet Protocol Suite (usually referred to as just TCP/IP)@footnote{It
|
|
should be noted that although the Internet seems to have conquered the
|
|
world, there are other networking protocol suites in existence and in use.}
|
|
consists of a number of different protocols at different levels or ``layers.''
|
|
For our purposes, three protocols provide the fundamental communications
|
|
mechanisms. All other defined protocols are referred to as user-level
|
|
protocols (e.g., HTTP, used later in this @value{DOCUMENT}).
|
|
|
|
@menu
|
|
* Basic Protocols:: The basic protocols.
|
|
* Ports:: The idea behind ports.
|
|
@end menu
|
|
|
|
@node Basic Protocols, Ports, The TCP/IP Protocols, The TCP/IP Protocols
|
|
@subsection The Basic Internet Protocols
|
|
|
|
@table @asis
|
|
@item IP
|
|
The Internet Protocol. This protocol is almost never used directly by
|
|
applications. It provides the basic packet delivery and routing infrastructure
|
|
of the Internet. Much like the phone company's switching centers or the Post
|
|
Office's trucks, it is not of much day-to-day interest to the regular user
|
|
(or programmer).
|
|
It happens to be a best effort datagram protocol.
|
|
In the early twenty-first century, there are two versions of this protocol
|
|
in use:
|
|
|
|
@table @asis
|
|
@item IPv4
|
|
The original version of the Internet Protocol, with 32-bit addresses, on which
|
|
most of the current Internet is based.
|
|
|
|
@item IPv6
|
|
The ``next generation'' of the Internet Protocol, with 128-bit addresses.
|
|
This protocol is in wide use in certain parts of the world, but has not
|
|
yet replaced IPv4.@footnote{There isn't an IPv5.}
|
|
@end table
|
|
|
|
Versions of the other protocols that sit ``atop'' IP exist for both
|
|
IPv4 and IPv6. However, as the IPv6 versions are fundamentally the same
|
|
as the original IPv4 versions, we will not distinguish further between them.
|
|
|
|
@item UDP
|
|
The User Datagram Protocol. This is a best effort datagram protocol.
|
|
It provides a small amount of extra reliability over IP, and adds
|
|
the notion of @dfn{ports}, described in @ref{Ports, ,TCP and UDP Ports}.
|
|
|
|
@item TCP
|
|
The Transmission Control Protocol. This is a duplex, reliable, sequenced
|
|
byte-stream protocol, again layered on top of IP, and also providing the
|
|
notion of ports. This is the protocol that you will most likely use
|
|
when using @command{gawk} for network programming.
|
|
@end table
|
|
|
|
All other user-level protocols use either TCP or UDP to do their basic
|
|
communications. Examples are SMTP (Simple Mail Transfer Protocol),
|
|
FTP (File Transfer Protocol), and HTTP (HyperText Transfer Protocol).
|
|
@cindex SMTP (Simple Mail Transfer Protocol)
|
|
@cindex Simple Mail Transfer Protocol (SMTP)
|
|
@cindex FTP (File Transfer Protocol)
|
|
@cindex HTTP (Hypertext Transfer Protocol)
|
|
|
|
@node Ports, , Basic Protocols, The TCP/IP Protocols
|
|
@subsection TCP and UDP Ports
|
|
|
|
In the postal system, the address on an envelope indicates a physical
|
|
location, such as a residence or office building. But there may be
|
|
more than one person at the location; thus you have to further quantify
|
|
the recipient by putting a person or company name on the envelope.
|
|
|
|
In the phone system, one phone number may represent an entire company,
|
|
in which case you need a person's extension number in order to
|
|
reach that individual directly. Or, when you call a home, you have to
|
|
say, ``May I please speak to ...'' before talking to the person directly.
|
|
|
|
IP networking provides the concept of addressing. An IP address represents
|
|
a particular computer, but no more. In order to reach the mail service
|
|
on a system, or the FTP or WWW service on a system, you must have some
|
|
way to further specify which service you want. In the Internet Protocol suite,
|
|
this is done with @dfn{port numbers}, which represent the services, much
|
|
like an extension number used with a phone number.
|
|
|
|
Port numbers are 16-bit integers. Unix and Unix-like systems reserve ports
|
|
below 1024 for ``well known'' services, such as SMTP, FTP, and HTTP.
|
|
Numbers 1024 and above may be used by any application, although there is no
|
|
promise made that a particular port number is always available.
|
|
|
|
@node Making Connections, , The TCP/IP Protocols, Introduction
|
|
@section Making TCP/IP Connections (And Some Terminology)
|
|
|
|
Two terms come up repeatedly when discussing networking:
|
|
@dfn{client} and @dfn{server}. For now, we'll discuss these terms
|
|
at the @dfn{connection level}, when first establishing connections
|
|
between two processes on different systems over a network.
|
|
(Once the connection is established, the higher level, or
|
|
@dfn{application level} protocols,
|
|
such as HTTP or FTP, determine who is the client and who is the
|
|
server. Often, it turns out that the client and server are the
|
|
same in both roles.)
|
|
|
|
@cindex servers
|
|
The @dfn{server} is the system providing the service, such as the
|
|
web server or email server. It is the @dfn{host} (system) which
|
|
is @emph{connected to} in a transaction.
|
|
For this to work though, the server must be expecting connections.
|
|
Much as there has to be someone at the office building to answer
|
|
the phone,@footnote{In the days before voice mail systems!} the
|
|
server process (usually) has to be started first and be waiting
|
|
for a connection.
|
|
|
|
@cindex clients
|
|
The @dfn{client} is the system requesting the service.
|
|
It is the system @emph{initiating the connection} in a transaction.
|
|
(Just as when you pick up the phone to call an office or store.)
|
|
|
|
In the TCP/IP framework, each end of a connection is represented by a pair
|
|
of (@var{address}, @var{port}) pairs. For the duration of the connection,
|
|
the ports in use at each end are unique, and cannot be used simultaneously
|
|
by other processes on the same system. (Only after closing a connection
|
|
can a new one be built up on the same port. This is contrary to the usual
|
|
behavior of fully developed web servers which have to avoid situations
|
|
in which they are not reachable. We have to pay this price in order to
|
|
enjoy the benefits of a simple communication paradigm in @command{gawk}.)
|
|
|
|
@cindex blocking
|
|
@cindex synchronous communications
|
|
Furthermore, once the connection is established, communications are
|
|
@dfn{synchronous}.@footnote{For the technically savvy, data reads
|
|
block---if there's no incoming data, the program is made to wait until
|
|
there is, instead of receiving a ``there's no data'' error return.} I.e.,
|
|
each end waits on the other to finish transmitting, before replying. This
|
|
is much like two people in a phone conversation. While both could talk
|
|
simultaneously, doing so usually doesn't work too well.
|
|
|
|
In the case of TCP, the synchronicity is enforced by the protocol when
|
|
sending data. Data writes @dfn{block} until the data have been received on the
|
|
other end. For both TCP and UDP, data reads block until there is incoming
|
|
data waiting to be read. This is summarized in the following table,
|
|
where an ``x'' indicates that the given action blocks.
|
|
|
|
@ifnottex
|
|
@multitable {Protocol} {Reads} {Writes}
|
|
@item TCP @tab x @tab x
|
|
@item UDP @tab x @tab
|
|
@end multitable
|
|
@end ifnottex
|
|
@tex
|
|
\centerline{
|
|
\vbox{\bigskip % space above the table (about 1 linespace)
|
|
% Because we have vertical rules, we can't let TeX insert interline space
|
|
% in its usual way.
|
|
\offinterlineskip
|
|
\halign{\hfil\strut# &\vrule #& \hfil#\hfil& \hfil#\hfil\cr
|
|
Protocol&&\quad Reads\quad &Writes\cr
|
|
\noalign{\hrule}
|
|
\omit&height 2pt\cr
|
|
\noalign{\hrule height0pt}% without this the rule does not extend; why?
|
|
TCP&&X&X\cr
|
|
UDP&&X&\cr
|
|
}}}
|
|
@end tex
|
|
|
|
@node Using Networking, Some Applications and Techniques, Introduction, Top
|
|
@comment node-name, next, previous, up
|
|
@chapter Networking With @command{gawk}
|
|
|
|
@cindex networks @subentry @command{gawk} and
|
|
@cindex @command{gawk} @subentry networking
|
|
The @command{awk} programming language was originally developed as a
|
|
pattern-matching language for writing short programs to perform
|
|
data manipulation tasks.
|
|
@command{awk}'s strength is the manipulation of textual data
|
|
that is stored in files.
|
|
It was never meant to be used for networking purposes.
|
|
To exploit its features in a
|
|
networking context, it's necessary to use an access mode for network connections
|
|
that resembles the access of files as closely as possible.
|
|
|
|
@cindex Perl
|
|
@cindex Python
|
|
@cindex Tcl/Tk
|
|
@command{awk} is also meant to be a prototyping language. It is used
|
|
to demonstrate feasibility and to play with features and user interfaces.
|
|
This can be done with file-like handling of network
|
|
connections.
|
|
@command{gawk} trades the lack
|
|
of many of the advanced features of the TCP/IP family of protocols
|
|
for the convenience of simple connection handling.
|
|
The advanced
|
|
features are available when programming in C or Perl. In fact, the
|
|
network programming
|
|
in this @value{CHAPTER}
|
|
is very similar to what is described in books such as
|
|
@cite{Internet Programming with Python},
|
|
@cite{Advanced Perl Programming},
|
|
or
|
|
@cite{Web Client Programming with Perl}.
|
|
|
|
@cindex Perl @subentry @command{gawk} networking and
|
|
@cindex Python @subentry @command{gawk} networking and
|
|
@cindex Tcl/Tk @subentry @command{gawk} and
|
|
However, you can do the programming here without first having to learn object-oriented
|
|
ideology; underlying languages such as Tcl/Tk, Perl, Python; or all of
|
|
the libraries necessary to extend these languages before they are ready for the Internet.
|
|
|
|
@cindex Transmission Control Protocol @seeentry{TCP}
|
|
@cindex TCP (Transmission Control Protocol)
|
|
This @value{CHAPTER} demonstrates how to use the TCP protocol. The
|
|
UDP protocol is much less important for most users.
|
|
|
|
@menu
|
|
* Gawk Special Files:: How to do @command{gawk} networking.
|
|
* TCP Connecting:: Making a TCP connection.
|
|
* Troubleshooting:: Troubleshooting TCP/IP connections.
|
|
* Interacting:: Interacting with a service.
|
|
* Setting Up:: Setting up a service.
|
|
* Email:: Reading email.
|
|
* Web page:: Reading a Web page.
|
|
* Primitive Service:: A primitive Web service.
|
|
* Interacting Service:: A Web service with interaction.
|
|
* Simple Server:: A simple Web server.
|
|
* Caveats:: Network programming caveats.
|
|
* Challenges:: Where to go from here.
|
|
@end menu
|
|
|
|
@node Gawk Special Files, TCP Connecting, Using Networking, Using Networking
|
|
@comment node-name, next, previous, up
|
|
@section @command{gawk}'s Networking Mechanisms
|
|
|
|
The @samp{|&} operator for use in
|
|
communicating with a @dfn{coprocess} is described in
|
|
@ref{Two-way I/O, ,Two-way Communications With Another Process, gawk, GAWK: Effective AWK Programming}.
|
|
It shows how to do two-way I/O to a
|
|
separate process, sending it data with @code{print} or @code{printf} and
|
|
reading data with @code{getline}. If you haven't read it already, you should
|
|
detour there to do so.
|
|
|
|
@command{gawk} transparently extends the two-way I/O mechanism to simple networking through
|
|
the use of special @value{FN}s. When a ``coprocess'' that matches
|
|
the special files we are about to describe
|
|
is started, @command{gawk} creates the appropriate network
|
|
connection, and then two-way I/O proceeds as usual.
|
|
|
|
@c last comma is part of see-also
|
|
@cindex input/output, two-way, @seealso{@command{gawk}, networking}
|
|
@cindex TCP/IP @subentry sockets and
|
|
At the C, C++, and Perl level, networking is accomplished
|
|
via @dfn{sockets}, an Application Programming Interface (API) originally
|
|
developed at the University of California at Berkeley that is now used
|
|
almost universally for TCP/IP networking.
|
|
Socket level programming, while fairly straightforward, requires paying
|
|
attention to a number of details, as well as using binary data. It is not
|
|
well-suited for use from a high-level language like @command{awk}.
|
|
The special files provided in @command{gawk} hide the details from
|
|
the programmer, making things much simpler and easier to use.
|
|
@c Who sez we can't toot our own horn occasionally?
|
|
|
|
@cindex filenames, for network access
|
|
@cindex @command{gawk} @subentry networking @subentry filenames
|
|
@cindex networks @subentry @command{gawk} and @subentry filenames
|
|
The special @value{FN} for network access is made up of several fields, all
|
|
of which are mandatory:
|
|
|
|
@example
|
|
/@var{net-type}/@var{protocol}/@var{localport}/@var{hostname}/@var{remoteport}
|
|
@end example
|
|
|
|
@cindex @code{/inet/} files (@command{gawk})
|
|
@cindex files @subentry @code{/inet/} (@command{gawk})
|
|
@cindex localport field
|
|
@cindex remoteport field
|
|
The @var{net-type} field lets you specify IPv4 versus IPv6, or lets
|
|
you allow the system to choose.
|
|
|
|
@menu
|
|
* Special File Fields:: The fields in the special file name.
|
|
* Comparing Protocols:: Differences between the protocols.
|
|
@end menu
|
|
|
|
@node Special File Fields, Comparing Protocols, Gawk Special Files, Gawk Special Files
|
|
@subsection The Fields of the Special @value{FFN}
|
|
This @value{SECTION} explains the meaning of all of the fields,
|
|
as well as the range of values and the defaults.
|
|
All of the fields are mandatory. To let the system pick a value,
|
|
or if the field doesn't apply to the protocol, specify it as @samp{0} (zero):
|
|
|
|
@table @var
|
|
@cindex network type field
|
|
@c last comma is part of secondary
|
|
@cindex TCP/IP @subentry network type, selecting
|
|
@item net-type
|
|
This is one of @samp{inet4} for IPv4, @samp{inet6} for IPv6,
|
|
or @samp{inet} to use the system default (which is likely to be IPv4).
|
|
For the rest of this document, we will use the generic @samp{/inet}
|
|
in our descriptions of how @command{gawk}'s networking works.
|
|
|
|
@cindex protocol field
|
|
@c last comma is part of secondary
|
|
@cindex TCP/IP @subentry protocols, selecting
|
|
@item protocol
|
|
Determines which member of the TCP/IP
|
|
family of protocols is selected to transport the data across the
|
|
network. There are two possible values (always written in lowercase):
|
|
@samp{tcp} and @samp{udp}. The exact meaning of each is
|
|
explained later in this @value{SECTION}.
|
|
|
|
@item localport
|
|
@cindex networks @subentry ports @subentry specifying
|
|
Determines which port on the local
|
|
machine is used to communicate across the network. Application-level clients
|
|
usually use @samp{0} to indicate they do not care which local port is
|
|
used---instead they specify a remote port to connect to.
|
|
|
|
It is vital for
|
|
application-level servers to use a number different from @samp{0} here
|
|
because their service has to be available at a specific publicly known
|
|
port number. It is possible to use a name from @file{/etc/services} here.
|
|
|
|
@item hostname
|
|
@cindex hostname field
|
|
@cindex servers @subentry as hosts
|
|
Determines which remote host is to
|
|
be at the other end of the connection.
|
|
Application-level clients must enter a name different from @samp{0}.
|
|
The name can be either symbolic
|
|
(e.g., @samp{jpl-devvax.jpl.nasa.gov}) or numeric (e.g., @samp{128.149.1.143}).
|
|
|
|
Application-level servers must fill
|
|
this field with a @samp{0} to indicate their being open for all other hosts
|
|
to connect to them and enforce connection level server behavior this way.
|
|
It is not possible for an application-level server to restrict its
|
|
availability to one remote host by entering a host name here.
|
|
|
|
@item remoteport
|
|
Determines which port on the remote
|
|
machine is used to communicate across the network.
|
|
For @file{/inet/tcp} and @file{/inet/udp},
|
|
application-level clients @emph{must} use a number
|
|
other than @samp{0} to indicate to which port on the remote machine
|
|
they want to connect.
|
|
|
|
Application-level servers must not fill this field with
|
|
a @samp{0}. Instead they specify a local port to which clients connect.
|
|
It is possible to use a name from @file{/etc/services} here.
|
|
@end table
|
|
|
|
@cindex networks @subentry @command{gawk} and @subentry connections
|
|
@cindex @command{gawk} @subentry networking @subentry connections
|
|
Experts in network programming will notice that the usual
|
|
client/server asymmetry found at the level of the socket API is not visible
|
|
here. This is for the sake of simplicity of the high-level concept. If this
|
|
asymmetry is necessary for your application,
|
|
use another language.
|
|
For @command{gawk}, it is
|
|
more important to enable users to write a client program with a minimum
|
|
of code. What happens when first accessing a network connection is seen
|
|
in the following pseudocode:
|
|
|
|
@smallexample
|
|
if ((name of remote host given) && (other side accepts connection)) @{
|
|
rendez-vous successful; transmit with getline or print
|
|
@} else @{
|
|
if ((other side did not accept) && (localport == 0))
|
|
exit unsuccessful
|
|
if (TCP) @{
|
|
set up a server accepting connections
|
|
this means waiting for the client on the other side to connect
|
|
@} else
|
|
ready
|
|
@}
|
|
@end smallexample
|
|
|
|
The exact behavior of this algorithm depends on the values of the
|
|
fields of the special @value{FN}. When in doubt, @ref{table-inet-components}
|
|
gives you the combinations of values and their meaning. If this
|
|
table is too complicated, focus on the three lines printed in
|
|
@strong{bold}. All the examples in
|
|
@ref{Using Networking, ,Networking With @command{gawk}},
|
|
use only the
|
|
patterns printed in bold letters.
|
|
|
|
@float Table,table-inet-components
|
|
@caption{@code{/inet} Special File Components}
|
|
@multitable @columnfractions .15 .15 .15 .15 .40
|
|
@headitem @sc{protocol} @tab @sc{local port} @tab @sc{host name}
|
|
@tab @sc{remote port} @tab @sc{Resulting connection-level behavior}
|
|
@item @strong{tcp} @tab @strong{0} @tab @strong{x} @tab @strong{x} @tab
|
|
@strong{Dedicated client, fails if immediately connecting to a
|
|
server on the other side fails}
|
|
@item udp @tab 0 @tab x @tab x @tab Dedicated client
|
|
@item @strong{tcp, udp} @tab @strong{x} @tab @strong{x} @tab @strong{x} @tab
|
|
@strong{Client, switches to dedicated server if necessary}
|
|
@item @strong{tcp, udp} @tab @strong{x} @tab @strong{0} @tab @strong{0} @tab
|
|
@strong{Dedicated server}
|
|
@item tcp, udp @tab x @tab x @tab 0 @tab Invalid
|
|
@item tcp, udp @tab 0 @tab 0 @tab x @tab Invalid
|
|
@item tcp, udp @tab x @tab 0 @tab x @tab Invalid
|
|
@item tcp, udp @tab 0 @tab 0 @tab 0 @tab Invalid
|
|
@item tcp, udp @tab 0 @tab x @tab 0 @tab Invalid
|
|
@end multitable
|
|
@end float
|
|
|
|
In general, TCP is the preferred mechanism to use. It is the simplest
|
|
protocol to understand and to use. Use UDP only if circumstances
|
|
demand low-overhead.
|
|
|
|
@node Comparing Protocols, , Special File Fields, Gawk Special Files
|
|
@subsection Comparing Protocols
|
|
|
|
This @value{SECTION} develops a pair of programs (sender and receiver)
|
|
that do nothing but send a timestamp from one machine to another. The
|
|
sender and the receiver are implemented with each of the two protocols
|
|
available and demonstrate the differences between them.
|
|
|
|
@menu
|
|
* File /inet/tcp:: The TCP special file.
|
|
* File /inet/udp:: The UDP special file.
|
|
@end menu
|
|
|
|
@node File /inet/tcp, File /inet/udp, Comparing Protocols, Comparing Protocols
|
|
@subsubsection @file{/inet/tcp}
|
|
@cindex @code{/inet/tcp} special files (@command{gawk})
|
|
@cindex files @subentry @code{/inet/tcp} (@command{gawk})
|
|
@cindex TCP (Transmission Control Protocol)
|
|
Once again, always use TCP.
|
|
(Use UDP when low overhead is a necessity.)
|
|
The first example is the sender
|
|
program:
|
|
|
|
@example
|
|
# Server
|
|
BEGIN @{
|
|
print strftime() |& "/inet/tcp/8888/0/0"
|
|
close("/inet/tcp/8888/0/0")
|
|
@}
|
|
@end example
|
|
|
|
The receiver is very simple:
|
|
|
|
@example
|
|
# Client
|
|
BEGIN @{
|
|
"/inet/tcp/0/localhost/8888" |& getline
|
|
print $0
|
|
close("/inet/tcp/0/localhost/8888")
|
|
@}
|
|
@end example
|
|
|
|
TCP guarantees that the bytes arrive at the receiving end in exactly
|
|
the same order that they were sent. No byte is lost
|
|
(except for broken connections), doubled, or out of order. Some
|
|
overhead is necessary to accomplish this, but this is the price to pay for
|
|
a reliable service.
|
|
It does matter which side starts first. The sender/server has to be started
|
|
first, and it waits for the receiver to read a line.
|
|
|
|
@node File /inet/udp, , File /inet/tcp, Comparing Protocols
|
|
@subsubsection @file{/inet/udp}
|
|
@cindex @code{/inet/udp} special files (@command{gawk})
|
|
@cindex files @subentry @code{/inet/udp} (@command{gawk})
|
|
@cindex UDP (User Datagram Protocol)
|
|
@cindex User Datagram Protocol @seeentry{UDP}
|
|
The server and client programs that use UDP are almost identical to their TCP counterparts;
|
|
only the @var{protocol} has changed. As before, it does matter which side
|
|
starts first. The receiving side blocks and waits for the sender.
|
|
In this case, the receiver/client has to be started first:
|
|
|
|
@example
|
|
# Server
|
|
BEGIN @{
|
|
print strftime() |& "/inet/udp/8888/0/0"
|
|
close("/inet/udp/8888/0/0")
|
|
@}
|
|
@end example
|
|
|
|
The receiver is almost identical to the TCP receiver:
|
|
|
|
@example
|
|
# Client
|
|
BEGIN @{
|
|
print "hi!" |& "/inet/udp/0/localhost/8888"
|
|
"/inet/udp/0/localhost/8888" |& getline
|
|
print $0
|
|
close("/inet/udp/0/localhost/8888")
|
|
@}
|
|
@end example
|
|
|
|
In the case of UDP, the initial @code{print} command is the one
|
|
that actually sends data so that there is a connection.
|
|
UDP and ``connection'' sounds strange to anyone
|
|
who has learned that UDP is a connectionless protocol.
|
|
Here, ``connection'' means that the @code{connect()} system call
|
|
has completed its work and completed the ``association''
|
|
between a certain socket and an IP address. Thus there are
|
|
subtle differences between @code{connect()} for TCP and UDP;
|
|
see the man page for details.@footnote{This subtlety
|
|
is just one of many details that are hidden in the socket
|
|
API, invisible and intractable for the @command{gawk} user.
|
|
The developers are currently considering how to rework the
|
|
network facilities to make them easier to understand and use.}
|
|
|
|
UDP cannot guarantee that the datagrams at the receiving end will arrive in exactly
|
|
the same order they were sent. Some datagrams could be
|
|
lost, some doubled, and some could arrive out of order.
|
|
But no overhead is necessary to
|
|
accomplish this. This unreliable behavior is good enough for tasks
|
|
such as data acquisition, logging, and even stateless services like
|
|
the original versions of NFS.
|
|
|
|
@node TCP Connecting, Troubleshooting, Gawk Special Files, Using Networking
|
|
@section Establishing a TCP Connection
|
|
|
|
@cindex TCP (Transmission Control Protocol) @subentry connection, establishing
|
|
@cindex networks @subentry @command{gawk} and @subentry connections
|
|
@cindex @command{gawk} @subentry networking @subentry connections
|
|
Let's observe a network connection at work. Type in the following program
|
|
and watch the output. Within a second, it connects via TCP (@file{/inet/tcp})
|
|
to a remote server and asks the service
|
|
@samp{daytime} on the machine what time it is:
|
|
|
|
@cindex @code{getline} command
|
|
@example
|
|
@c file eg/network/daytimeclient.awk
|
|
BEGIN @{
|
|
daytime_server = "time-a-g.nist.gov"
|
|
daytime_connection = "/inet/tcp/0/" daytime_server "/daytime"
|
|
daytime_connection |& getline
|
|
print $0
|
|
daytime_connection |& getline
|
|
print $0
|
|
close(daytime_connection)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
Even experienced @command{awk} users will find the fourth and sixth line
|
|
strange in two respects:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
A string containing the name of a special file is used as a shell command that pipes its output
|
|
into @code{getline}. One would rather expect to see the special file
|
|
being read like any other file (@samp{getline <
|
|
"/inet/tcp/0/time-a-g.nist.gov/daytime"}).
|
|
|
|
@item
|
|
@cindex @code{|} (vertical bar), @code{|&} operator (I/O)
|
|
@cindex vertical bar (@code{|}), @code{|&} operator (I/O)
|
|
The operator @samp{|&} has not been part of any @command{awk}
|
|
implementation (until now).
|
|
It is actually the only extension of the @command{awk}
|
|
language needed (apart from the special files) to introduce network access.
|
|
@end itemize
|
|
|
|
@cindex pipes, networking and
|
|
The @samp{|&} operator was introduced in @command{gawk} 3.1 in order to
|
|
overcome the crucial restriction that access to files and pipes in
|
|
@command{awk} is always unidirectional. It was formerly impossible to use
|
|
both access modes on the same file or pipe. Instead of changing the whole
|
|
concept of file access, the @samp{|&} operator
|
|
behaves exactly like the usual pipe operator except for two additions:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
Normal shell commands connected to their @command{gawk} program with a @samp{|&}
|
|
pipe can be accessed bidirectionally. The @samp{|&} turns out to be a quite
|
|
general, useful, and natural extension of @command{awk}.
|
|
|
|
@item
|
|
Pipes that consist of a special @value{FN} for network connections are not
|
|
executed as shell commands. Instead, they can be read and written to, just
|
|
like a full-duplex network connection.
|
|
@end itemize
|
|
|
|
In the earlier example, the @samp{|&} operator tells @code{getline}
|
|
to read a line from the special file @file{/inet/tcp/0/time-a-g.nist.gov/daytime}.
|
|
We could also have printed a line into the special file. But instead we just
|
|
consumed an empty leading line, printed it, then read a line with the time,
|
|
printed that, and closed the connection.
|
|
(While we could just let @command{gawk} close the connection by finishing
|
|
the program, in this @value{DOCUMENT}
|
|
we are pedantic and always explicitly close the connections.)
|
|
|
|
Network services like @file{daytime} are not really useful because
|
|
there are so many better ways to print the current time.
|
|
In the early days of TCP networking, such a service may have looked
|
|
like a good idea for testing purposes. Later, simple TCP services
|
|
like these have been used to teach TCP/IP networking and therefore
|
|
you can still find much educational material of good quality on the
|
|
Internet about such outdated services. The
|
|
@uref{https://tf.nist.gov/tf-cgi/servers.cgi, list of servers}
|
|
that still support the legacy service
|
|
@uref{https://en.wikipedia.org/wiki/Daytime_Protocol, daytime}
|
|
can be found at Wikipedia. We hesitated to use this service in
|
|
this manual because it is hard to find servers that still support
|
|
services like @file{daytime} openly to the Internet.
|
|
Later on we will see that some of these nostalgic
|
|
protocols have turned into security risks.
|
|
|
|
@node Troubleshooting, Interacting, TCP Connecting, Using Networking
|
|
@section Troubleshooting Connection Problems
|
|
@cindex advanced features, network connections
|
|
@c last comma is part of secondary
|
|
@cindex troubleshooting @subentry networks @subentry connections
|
|
It may well be that for some reason the program shown in the previous example does not run on your
|
|
machine. When looking at possible reasons for this, you will learn much
|
|
about typical problems that arise in network programming.
|
|
@ignore
|
|
First of all,
|
|
your implementation of @command{gawk} may not support network access
|
|
because it is
|
|
a pre-3.1 version or you do not have a network interface in your machine.
|
|
Perhaps your machine uses some other protocol, such as
|
|
DECnet or Novell's IPX.
|
|
@end ignore
|
|
|
|
For the rest of this @value{CHAPTER}, we will assume you work on a POSIX-style
|
|
system that supports TCP/IP. If the previous example program does not
|
|
run on your machine, it may help to replace the value assigned to the variable
|
|
@samp{daytime_server} with the name (or the IP address) of another server
|
|
from the list mentioned above.
|
|
Now you should see the date and time being printed by the program,
|
|
otherwise you may have run out of servers that support the @samp{daytime} service.
|
|
|
|
Try changing the service to @samp{chargen} or @samp{ftp}. This way, the program
|
|
connects to other services that should give you some response. If you are
|
|
curious, you should have a look at your @file{/etc/services} file. It could
|
|
look like this:
|
|
|
|
@smallexample
|
|
# /etc/services:
|
|
#
|
|
# Network services, Internet style
|
|
#
|
|
# Name Number/Protocol Alternate name # Comments
|
|
|
|
echo 7/tcp
|
|
echo 7/udp
|
|
discard 9/tcp sink null
|
|
discard 9/udp sink null
|
|
daytime 13/tcp
|
|
daytime 13/udp
|
|
chargen 19/tcp ttytst source
|
|
chargen 19/udp ttytst source
|
|
ftp 21/tcp
|
|
telnet 23/tcp
|
|
smtp 25/tcp mail
|
|
finger 79/tcp
|
|
www 80/tcp http # WorldWideWeb HTTP
|
|
www 80/udp # HyperText Transfer Protocol
|
|
pop-2 109/tcp postoffice # POP version 2
|
|
pop-2 109/udp
|
|
pop-3 110/tcp # POP version 3
|
|
pop-3 110/udp
|
|
nntp 119/tcp readnews untp # USENET News
|
|
irc 194/tcp # Internet Relay Chat
|
|
irc 194/udp
|
|
@dots{}
|
|
@end smallexample
|
|
|
|
@cindex Linux
|
|
@cindex GNU/Linux
|
|
@cindex Microsoft Windows @subentry networking
|
|
Here, you find a list of services that traditional Unix machines usually
|
|
support. If your GNU/Linux machine does not do so, it may be that these
|
|
services are switched off in some startup script. Systems running some
|
|
flavor of Microsoft Windows usually do @emph{not} support these services.
|
|
Nevertheless, it @emph{is} possible to do networking with @command{gawk} on
|
|
Microsoft
|
|
Windows.@footnote{Microsoft preferred to ignore the TCP/IP
|
|
family of protocols until 1995. Then came the rise of the Netscape browser
|
|
as a landmark ``killer application.'' Microsoft added TCP/IP support and
|
|
their own browser to Microsoft Windows 95 at the last minute. They even back-ported
|
|
their TCP/IP implementation to Microsoft Windows for Workgroups 3.11, but it was
|
|
a rather rudimentary and half-hearted implementation. Nevertheless,
|
|
the equivalent of @file{/etc/services} resides under
|
|
@file{C:\WINNT\system32\drivers\etc\services} on Microsoft Windows 2000
|
|
and Microsoft Windows XP.
|
|
On Microsoft Windows 7, 8 and 10 there is a directory
|
|
@file{%WinDir%\System32\Drivers\Etc}
|
|
that holds the
|
|
@uref{https://support.microsoft.com/en-us/help/972034/how-to-reset-the-hosts-file-back-to-the-default, @file{hosts} file}
|
|
and probably also a
|
|
@uref{https://www.ibm.com/support/knowledgecenter/SSRNYG_7.2.1/com.ibm.rational.synergy.install.win.doc/topics/sg_r_igw_services_file.html, @file{services} file}.}
|
|
The first column of the file gives the name of the service, and
|
|
the second column gives a unique number and the protocol that one can use to connect to
|
|
this service.
|
|
The rest of the line is treated as a comment.
|
|
You see that some services (@samp{echo}) support TCP as
|
|
well as UDP.
|
|
|
|
@node Interacting, Setting Up, Troubleshooting, Using Networking
|
|
@section Interacting with a Network Service
|
|
|
|
The next program begins really interacting with a
|
|
network service by printing something into the special file. It asks the
|
|
so-called @command{finger} service if a user of the machine is logged in. When
|
|
testing this program, try to change the variable @samp{finger_server}
|
|
to some other machine name in your local network:
|
|
@c This really worked in 2020.
|
|
@c Thanks to some people at cmu.edu who keep this service alive.
|
|
@c https://www.techrepublic.com/article/everything-you-need-to-know-about-tcp-ips-finger-utility/
|
|
|
|
@example
|
|
@c file eg/network/fingerclient.awk
|
|
BEGIN @{
|
|
finger_server = "andrew.cmu.edu"
|
|
finger_connection = "/inet/tcp/0/" finger_server "/finger"
|
|
print "wnace" |& finger_connection
|
|
while ((finger_connection |& getline) > 0)
|
|
print $0
|
|
close(finger_connection)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
After telling the service on the machine which user to look for,
|
|
the program repeatedly reads lines that come as a reply. When no more
|
|
lines are available (because the service has closed the connection), the
|
|
program also closes the connection. If you tried to replace @samp{finger_server}
|
|
with some other server name, the script probably reported being unable to
|
|
open the connection, because most servers today no longer support this
|
|
service. Try replacing the login name of Professor Nace (@code{wnace})
|
|
with another login name (like @code{help}). You will receive a list of
|
|
login names similar to the one you asked for. In the 1980s you could get
|
|
a list of all users currently logged in by asking for an empty string (@code{""}).
|
|
|
|
@cindex Linux
|
|
@cindex GNU/Linux
|
|
The final @code{close()} call could be safely deleted from
|
|
the above script, because the operating system closes any open connection
|
|
by default when a script reaches the end of execution. But, in order to avoid
|
|
portability problems, it is best to always close connections explicitly.
|
|
@c FIXME: This following statement isn't really true; gawk flushes
|
|
@c and closes all open files before exiting.
|
|
With the Linux kernel,
|
|
for example, proper closing results in flushing of buffers. Letting
|
|
the close happen by default may result in discarding buffers.
|
|
|
|
When looking at @file{/etc/services} you may have noticed that the
|
|
@samp{daytime} service is also available with @samp{udp}. In the earlier
|
|
examples, change @samp{tcp} to @samp{udp} and try if the @samp{finger} and @samp{daytime}
|
|
clients still work as expected. They probably will not respond because
|
|
a wise administrator switched off these services.
|
|
But if they do, you may see the expected day and time message.
|
|
The program then hangs, because it waits for more lines to come from the
|
|
service. However, they never do. This behavior is a consequence of the
|
|
differences between TCP and UDP. When using UDP, neither party is
|
|
automatically informed about the other closing the connection.
|
|
Continuing to experiment this way reveals many other subtle
|
|
differences between TCP and UDP. To avoid such trouble, you should always
|
|
remember the advice Douglas E.@: Comer and David Stevens give in
|
|
Volume III of their series @cite{Internetworking With TCP}
|
|
(page 14):
|
|
|
|
@cindex TCP (Transmission Control Protocol) @subentry UDP and
|
|
@cindex UDP (User Datagram Protocol) @subentry TCP and
|
|
@cindex Internet @seeentry{networks}
|
|
@quotation
|
|
When designing client-server applications, beginners are strongly
|
|
advised to use TCP because it provides reliable, connection-oriented
|
|
communication. Programs only use UDP if the application protocol handles
|
|
reliability, the application requires hardware broadcast or multicast,
|
|
or the application cannot tolerate virtual circuit overhead.
|
|
@end quotation
|
|
|
|
This advice is actually quite dated and we hesitated to repeat it here.
|
|
But we left it in because we are still observing beginners running
|
|
into this pitfall. While this advice has aged quite well, some other
|
|
ideas from the 1980s have not. The @samp{finger} service may still be
|
|
available in Microsoft
|
|
@uref{https://docs.microsoft.com/en-us/windows-server/administration/windows-commands/finger, Windows Server 2019},
|
|
but it turned out to be a never-ending cause of trouble. First of all,
|
|
it is now obvious that a server should never reveal personal data about
|
|
its users to anonymous client software that connects over the wild wild Internet.
|
|
So every server on the Internet should reject @samp{finger} requests
|
|
(by disabling the port and by disabling the software serving this port).
|
|
But things got even worse in 2020 when it turned out that even the client
|
|
software (the @samp{finger} command documented in the link above) is a
|
|
security problem. A tool called
|
|
@uref{https://seclists.org/fulldisclosure/2020/Sep/30, DarkFinger}
|
|
allows to leverage the Microsoft Windows @samp{finger.exe} as a file downloader
|
|
and help evade network security devices.
|
|
|
|
@node Setting Up, Email, Interacting, Using Networking
|
|
@section Setting Up a Service
|
|
@c last comma is part of tertiary
|
|
@cindex networks @subentry @command{gawk} and @subentry service@comma{} establishing
|
|
@c last comma is part of tertiary
|
|
@cindex @command{gawk} @subentry networking @subentry service@comma{} establishing
|
|
The preceding programs behaved as clients that connect to a server somewhere
|
|
on the Internet and request a particular service. Now we set up such a
|
|
service to mimic the behavior of the @samp{daytime} service.
|
|
Such a server does not know in advance who is going to connect to it over
|
|
the network. Therefore, we cannot insert a name for the host to connect to
|
|
in our special @value{FN}.
|
|
|
|
Start the following program in one window. Notice that the service does
|
|
not have the name @samp{daytime}, but the number @samp{8888}.
|
|
From looking at @file{/etc/services}, you know that names like @samp{daytime}
|
|
are just mnemonics for predetermined 16-bit integers.
|
|
Only the system administrator (@code{root}) could enter
|
|
our new service into @file{/etc/services} with an appropriate name.
|
|
Also notice that the service name has to be entered into a different field
|
|
of the special @value{FN} because we are setting up a server, not a client:
|
|
|
|
@cindex @command{finger} utility
|
|
@cindex servers
|
|
@example
|
|
@c file eg/network/daytimeserver.awk
|
|
BEGIN @{
|
|
print strftime() |& "/inet/tcp/8888/0/0"
|
|
close("/inet/tcp/8888/0/0")
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
Now open another window on the same machine.
|
|
Copy the client program given as the first example
|
|
(@pxref{TCP Connecting, ,Establishing a TCP Connection})
|
|
to a new file and edit it, changing the variable @samp{daytime_server} to
|
|
@samp{localhost} and the port name @samp{daytime} to @samp{8888}.
|
|
Then start the modified client. You should get a reply like this:
|
|
|
|
@example
|
|
$ @kbd{gawk -f awklib/eg/network/daytimeclient.awk}
|
|
@print{} Sun Dec 27 17:33:57 CET 2020
|
|
@print{} Sun Dec 27 17:33:57 CET 2020
|
|
@end example
|
|
|
|
@noindent
|
|
Both programs explicitly close the connection.
|
|
|
|
@c first comma is part of primary
|
|
@cindex Microsoft Windows @subentry networking @subentry ports
|
|
@cindex networks @subentry ports @subentry reserved
|
|
@cindex Unix, network ports and
|
|
Now we will intentionally make a mistake to see what happens when the name
|
|
@samp{8888} (the port) is already used by another service.
|
|
Start the server
|
|
program in both windows. The first one works, but the second one
|
|
complains that it could not open the connection. Each port on a single
|
|
machine can only be used by one server program at a time. Now terminate the
|
|
server program and change the name @samp{8888} to @samp{echo}. After restarting it,
|
|
the server program does not run any more, and you know why: there is already
|
|
an @samp{echo} service running on your machine. But even if this isn't true,
|
|
you would not get
|
|
your own @samp{echo} server running on a Unix machine,
|
|
because the ports with numbers smaller
|
|
than 1024 (@samp{echo} is at port 7) are reserved for @code{root}.
|
|
On machines running some flavor of Microsoft Windows, there is no restriction
|
|
that reserves ports 1 to 1024 for a privileged user; hence, you can start
|
|
an @samp{echo} server there.
|
|
Even in later version of Microsoft Windows, this restriction of
|
|
the Unix world seems to have never been adopted
|
|
@uref{https://social.technet.microsoft.com/Forums/windowsserver/en-US/334f0770-eda9-475a-a27f-46b80ab7e872/does-windows10server2016-have-privileged-ports-?forum=ws2016,
|
|
@cite{Does windows(10/server-2016) have privileged ports?}}.
|
|
In Microsoft Windows it is the level of the firewall that handles
|
|
port access restrictions, not the level of the operating system's kernel.
|
|
|
|
Turning this short server program into something really useful is simple.
|
|
Imagine a server that first reads a @value{FN} from the client through the
|
|
network connection, then does something with the file and
|
|
sends a result back to the client. The server-side processing
|
|
could be:
|
|
|
|
@example
|
|
@c file eg/network/catpipeserver.awk
|
|
BEGIN @{
|
|
NetService = "/inet/tcp/8888/0/0"
|
|
NetService |& getline # sets $0 and the fields
|
|
CatPipe = ("cat " $1)
|
|
while ((CatPipe | getline) > 0)
|
|
print $0 |& NetService
|
|
close(NetService)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@noindent
|
|
and we would
|
|
have a remote copying facility. Such a server reads the name of a file
|
|
from any client that connects to it and transmits the contents of the
|
|
named file across the net. The server-side processing could also be
|
|
the execution of a command that is transmitted across the network. From this
|
|
example, you can see how simple it is to open up a security hole on your
|
|
machine. If you allow clients to connect to your machine and
|
|
execute arbitrary commands, anyone would be free to do @samp{rm -rf *}.
|
|
|
|
The client side connects to port number 8888 on the server side and
|
|
sends the name of the desired file to be sent across the same TCP
|
|
connection. The main loop reads all content coming in from the TCP
|
|
connection line-wise and prints it.
|
|
|
|
@example
|
|
@c file eg/network/catpipeclient.awk
|
|
BEGIN @{
|
|
NetService = "/inet/tcp/0/localhost/8888"
|
|
print "README" |& NetService
|
|
while ((NetService |& getline) > 0)
|
|
print $0
|
|
close(NetService)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@node Email, Web page, Setting Up, Using Networking
|
|
@section Reading Email
|
|
@cindex RFC 1939
|
|
@cindex RFC 821
|
|
@cindex @command{gawk} @subentry networking @subentry email
|
|
@cindex networks @subentry @command{gawk} and @subentry email
|
|
@cindex POP (Post Office Protocol)
|
|
@cindex SMTP (Simple Mail Transfer Protocol)
|
|
@cindex Post Office Protocol (POP)
|
|
@cindex Simple Mail Transfer Protocol (SMTP)
|
|
The distribution of email is usually done by dedicated email servers that
|
|
communicate with your machine using special protocols.
|
|
In this @value{SECTION} we show how simple the basic steps are.@footnote{No,
|
|
things are @emph{not} that simple any more. Things @emph{were} that simple
|
|
when email was young in the 20th century. These days, unencrypted plaintext
|
|
authentication is usually disallowed on non-secure connections.
|
|
Since encryption of network connections is not supported in @command{gawk},
|
|
you should not use @command{gawk} to write such scripts.
|
|
We left this @value{SECTION} as it is because it demonstrates how
|
|
application level protocols work in principle (a command being issued
|
|
by the client followed by a reply coming back). Unfortunately, modern
|
|
application level protocols are much more flexible in the sequence of
|
|
actions. For example, modern POP3 servers may introduce themselves
|
|
with an unprompted initial line that arrives before the initial command.
|
|
Dealing with such variance is not worth the effort in @command{gawk}.}
|
|
@c FIXME: This would be the proper place to refer to Arnold's work on
|
|
@c writing SMTP client and server.
|
|
|
|
To receive email, we use the Post Office Protocol (POP). Sending can
|
|
be done with the much older Simple Mail Transfer Protocol (SMTP).
|
|
|
|
@cindex email
|
|
When you type in the following program, replace the @var{emailhost} by the
|
|
name of your local email server. Ask your administrator if the server has a
|
|
POP service, and then use its name or number in the program below.
|
|
Now the program is ready to connect to your email server, but it will not
|
|
succeed in retrieving your mail because it does not yet know your login
|
|
name or password. Replace them in the program and it
|
|
shows you the first email the server has in store:
|
|
|
|
@example
|
|
@c file eg/network/mailpopclient.awk
|
|
BEGIN @{
|
|
POPService = "/inet/tcp/0/@var{emailhost}/pop3"
|
|
RS = ORS = "\r\n"
|
|
print "user @var{name}" |& POPService
|
|
POPService |& getline
|
|
print "pass @var{password}" |& POPService
|
|
POPService |& getline
|
|
print "retr 1" |& POPService
|
|
POPService |& getline
|
|
if ($1 != "+OK") exit
|
|
print "quit" |& POPService
|
|
RS = "\r\n\\.\r\n"
|
|
POPService |& getline
|
|
print $0
|
|
close(POPService)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@cindex RFC 1939
|
|
@cindex record separators @subentry POP and
|
|
@cindex @code{RS} variable @subentry POP and
|
|
@cindex @code{ORS} variable @subentry POP and
|
|
@cindex POP (Post Office Protocol)
|
|
We redefine the record separators @code{RS} and @code{ORS} because the
|
|
protocol (POP) requires CR-LF to separate lines. After identifying
|
|
yourself to the email service, the command @samp{retr 1} instructs the
|
|
service to send the first of all your email messages in line. If the service
|
|
replies with something other than @samp{+OK}, the program exits; maybe there
|
|
is no email. Otherwise, the program first announces that it intends to finish
|
|
reading email, and then redefines @code{RS} in order to read the entire
|
|
email as multiline input in one record. From the POP RFC, we know that the body
|
|
of the email always ends with a single line containing a single dot.
|
|
The program looks for this using @samp{RS = "\r\n\\.\r\n"}.
|
|
When it finds this sequence in the mail message, it quits.
|
|
You can invoke this program as often as you like; it does not delete the
|
|
message it reads, but instead leaves it on the server.
|
|
|
|
@node Web page, Primitive Service, Email, Using Networking
|
|
@section Reading a Web Page
|
|
@cindex web pages
|
|
@cindex HTTP (Hypertext Transfer Protocol)
|
|
@cindex Hypertext Transfer Protocol @seeentry{HTTP}
|
|
@cindex RFC 2068
|
|
@cindex RFC 2616
|
|
|
|
Retrieving a web page from a web server is as simple as
|
|
retrieving email from an email server. We only have to use a
|
|
similar, but not identical, protocol and a different port. The name of the
|
|
protocol is HyperText Transfer Protocol (HTTP) and the port number is usually
|
|
80. As in the preceding @value{SECTION}, ask your administrator about the
|
|
name of your local web server or proxy web server and its port number
|
|
for HTTP requests.
|
|
|
|
The following program employs a rather crude approach toward retrieving a
|
|
web page. It uses the prehistoric syntax of HTTP 0.9, which almost all
|
|
web servers still support. The most noticeable thing about it is that the
|
|
program directs the request to the local proxy server whose name you insert
|
|
in the special @value{FN} (which in turn calls @samp{www.yahoo.com}):
|
|
|
|
@example
|
|
BEGIN @{
|
|
RS = ORS = "\r\n"
|
|
HttpService = "/inet/tcp/0/@var{proxy}/80"
|
|
print "GET http://www.yahoo.com" |& HttpService
|
|
while ((HttpService |& getline) > 0)
|
|
print $0
|
|
close(HttpService)
|
|
@}
|
|
@end example
|
|
|
|
@cindex RFC 1945
|
|
@cindex record separators @subentry HTTP and
|
|
@cindex @code{RS} variable @subentry HTTP and
|
|
@cindex @code{ORS} variable @subentry HTTP and
|
|
@cindex HTTP (Hypertext Transfer Protocol) @subentry record separators and
|
|
@cindex HTML (Hypertext Markup Language)
|
|
@cindex Hypertext Markup Language (HTML)
|
|
Again, lines are separated by a redefined @code{RS} and @code{ORS}.
|
|
The @code{GET} request that we send to the server is the only kind of
|
|
HTTP request that existed when the web was created in the early 1990s.
|
|
HTTP calls this @code{GET} request a ``method,'' which tells the
|
|
service to transmit a web page (here the home page of the Yahoo! search
|
|
engine). Version 1.0 added the request methods @code{HEAD} and
|
|
@code{POST}. The current version of HTTP is 1.1,@footnote{Version 1.0 of
|
|
HTTP was defined in RFC 1945. HTTP 1.1 was initially specified in RFC
|
|
2068. In June 1999, RFC 2068 was made obsolete by RFC 2616, an update
|
|
without any substantial changes.}@footnote{@uref{https://en.wikipedia.org/wiki/HTTP/2,
|
|
Version 2.0 of HTTP}
|
|
was defined in
|
|
@uref{https://tools.ietf.org/html/rfc7540,RFC7540}
|
|
and was derived from Google's
|
|
@uref{https://en.wikipedia.org/wiki/SPDY,SPDY}
|
|
protocol. It is said to be widely supported. As of 2020 the most popular
|
|
web sites still identify themselves as supporting HTTP/1.1.
|
|
@uref{https://en.wikipedia.org/wiki/HTTP/3, Version 3.0 of HTTP}
|
|
is still a draft and was derived from Google's
|
|
@uref{https://en.wikipedia.org/wiki/QUIC,QUIC} protocol.}
|
|
and knows the additional request
|
|
methods @code{OPTIONS}, @code{PUT}, @code{DELETE}, and @code{TRACE}.
|
|
You can fill in any valid web address, and the program prints the
|
|
HTML code of that page to your screen.
|
|
|
|
Notice the similarity between the responses of the POP and HTTP
|
|
services. First, you get a header that is terminated by an empty line, and
|
|
then you get the body of the page in HTML. The lines of the headers also
|
|
have the same form as in POP. There is the name of a parameter,
|
|
then a colon, and finally the value of that parameter.
|
|
|
|
@cindex CGI (Common Gateway Interface) @subentry dynamic web pages and
|
|
@cindex Common Gateway Interface @seeentry{CGI}
|
|
@cindex GIF image format
|
|
@cindex PNG image format
|
|
@cindex images @subentry retrieving over networks
|
|
Images (@file{.png} or @file{.gif} files) can also be retrieved this way,
|
|
but then you
|
|
get binary data that should be redirected into a file. Another
|
|
application is calling a CGI (Common Gateway Interface) script on some
|
|
server. CGI scripts are used when the contents of a web page are not
|
|
constant, but generated on demand at the moment you send a request
|
|
for the page. For example, to get a detailed report about the current
|
|
quotes of Motorola stock shares, call a CGI script at Yahoo! with
|
|
the following:
|
|
|
|
@example
|
|
get = "GET http://quote.yahoo.com/q?s=MOT&d=t"
|
|
print get |& HttpService
|
|
@end example
|
|
|
|
You can also request weather reports this way.
|
|
|
|
@node Primitive Service, Interacting Service, Web page, Using Networking
|
|
@section A Primitive Web Service
|
|
@cindex web service
|
|
Now we know enough about HTTP to set up a primitive web service that just
|
|
says @code{"Hello, world"} when someone connects to it with a browser.
|
|
Compared
|
|
to the situation in the preceding @value{SECTION}, our program changes the role. It
|
|
tries to behave just like the server we have observed. Since we are setting
|
|
up a server here, we have to insert the port number in the @samp{localport}
|
|
field of the special @value{FN}. The other two fields (@var{hostname} and
|
|
@var{remoteport}) have to contain a @samp{0} because we do not know in
|
|
advance which host will connect to our service.
|
|
|
|
In the early 1990s, all a server had to do was send an HTML document and
|
|
close the connection. Here, we adhere to the modern syntax of HTTP.
|
|
The steps are as follows:
|
|
|
|
@enumerate 1
|
|
@item
|
|
Send a status line telling the web browser that everything
|
|
is okay.
|
|
|
|
@item
|
|
Send a line to tell the browser how many bytes follow in the
|
|
body of the message. This was not necessary earlier because both
|
|
parties knew that the document ended when the connection closed. Nowadays
|
|
it is possible to stay connected after the transmission of one web page.
|
|
This avoids the network traffic necessary for repeatedly establishing
|
|
TCP connections for requesting several images. Thus, it is necessary to tell
|
|
the receiving party how many bytes will be sent. The header is terminated
|
|
as usual with an empty line.
|
|
|
|
@item
|
|
Send the @code{"Hello, world"} body
|
|
in HTML.
|
|
The useless @code{while} loop swallows the request of the browser.
|
|
We could actually omit the loop, and on most machines the program would still
|
|
work.
|
|
First, start the following program:
|
|
@end enumerate
|
|
|
|
@example
|
|
@c file eg/network/hello-serv.awk
|
|
BEGIN @{
|
|
RS = ORS = "\r\n"
|
|
HttpService = "/inet/tcp/8080/0/0"
|
|
Hello = "<HTML><HEAD>" \
|
|
"<TITLE>A Famous Greeting</TITLE></HEAD>" \
|
|
"<BODY><H1>Hello, world</H1></BODY></HTML>"
|
|
Len = length(Hello) + length(ORS)
|
|
print "HTTP/1.0 200 OK" |& HttpService
|
|
print "Content-Length: " Len ORS |& HttpService
|
|
print Hello |& HttpService
|
|
while ((HttpService |& getline) > 0)
|
|
continue;
|
|
close(HttpService)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
Now, on the same machine, start your favorite browser and let it point to
|
|
@uref{http://localhost:8080} (the browser needs to know on which port
|
|
our server is listening for requests). If this does not work, the browser
|
|
probably tries to connect to a proxy server that does not know your machine.
|
|
If so, change the browser's configuration so that the browser does not try to
|
|
use a proxy to connect to your machine.
|
|
|
|
@node Interacting Service, Simple Server, Primitive Service, Using Networking
|
|
@section A Web Service with Interaction
|
|
@cindex @command{gawk} @subentry web and @seeentry{web service}
|
|
@cindex web browsers, @seeentry{web service}
|
|
@c comma is part of primary
|
|
@cindex HTTP server, core logic
|
|
@cindex servers @subentry HTTP
|
|
@ifinfo
|
|
This node shows how to set up a simple web server.
|
|
The subnode is a library file that we will use with all the examples in
|
|
@ref{Some Applications and Techniques}.
|
|
@end ifinfo
|
|
|
|
@menu
|
|
* CGI Lib:: A simple CGI library.
|
|
@end menu
|
|
|
|
Setting up a web service that allows user interaction is more difficult and
|
|
shows us the limits of network access in @command{gawk}. In this @value{SECTION},
|
|
we develop a main program (a @code{BEGIN} pattern and its action)
|
|
that will become the core of event-driven execution controlled by a
|
|
graphical user interface (GUI).
|
|
Each HTTP event that the user triggers by some action within the browser
|
|
is received in this central procedure. Parameters and menu choices are
|
|
extracted from this request, and an appropriate measure is taken according to
|
|
the user's choice:
|
|
|
|
@cindex HTTP server, core logic
|
|
@example
|
|
BEGIN @{
|
|
if (MyHost == "") @{
|
|
"uname -n" | getline MyHost
|
|
close("uname -n")
|
|
@}
|
|
if (MyPort == 0) MyPort = 8080
|
|
HttpService = "/inet/tcp/" MyPort "/0/0"
|
|
MyPrefix = "http://" MyHost ":" MyPort
|
|
SetUpServer()
|
|
while ("awk" != "complex") @{
|
|
# header lines are terminated this way
|
|
RS = ORS = "\r\n"
|
|
Status = 200 # this means OK
|
|
Reason = "OK"
|
|
Header = TopHeader
|
|
Document = TopDoc
|
|
Footer = TopFooter
|
|
if (GETARG["Method"] == "GET") @{
|
|
HandleGET()
|
|
@} else if (GETARG["Method"] == "HEAD") @{
|
|
# not yet implemented
|
|
@} else if (GETARG["Method"] != "") @{
|
|
print "bad method", GETARG["Method"]
|
|
@}
|
|
Prompt = Header Document Footer
|
|
print "HTTP/1.0", Status, Reason |& HttpService
|
|
print "Connection: Close" |& HttpService
|
|
print "Pragma: no-cache" |& HttpService
|
|
len = length(Prompt) + length(ORS)
|
|
print "Content-length:", len |& HttpService
|
|
print ORS Prompt |& HttpService
|
|
# ignore all the header lines
|
|
while ((HttpService |& getline) > 0)
|
|
;
|
|
# stop talking to this client
|
|
close(HttpService)
|
|
# wait for new client request
|
|
HttpService |& getline
|
|
# do some logging
|
|
print systime(), strftime(), $0
|
|
# read request parameters
|
|
CGI_setup($1, $2, $3)
|
|
@}
|
|
@}
|
|
@end example
|
|
|
|
This web server presents menu choices in the form of HTML links.
|
|
Therefore, it has to tell the browser the name of the host it is
|
|
residing on. When starting the server, the user may supply the name
|
|
of the host from the command line with @samp{gawk -v MyHost="Rumpelstilzchen"}.
|
|
If the user does not do this, the server looks up the name of the host it is
|
|
running on for later use as a web address in HTML documents. The same
|
|
applies to the port number. These values are inserted later into the
|
|
HTML content of the web pages to refer to the home system.
|
|
|
|
Each server that is built around this core has to initialize some
|
|
application-dependent variables (such as the default home page) in a function
|
|
@code{SetUpServer()}, which is called immediately before entering the
|
|
infinite loop of the server. For now, we will write an instance that
|
|
initiates a trivial interaction. With this home page, the client user
|
|
can click on two possible choices, and receive the current date either
|
|
in human-readable format or in seconds since 1970:
|
|
|
|
@example
|
|
function SetUpServer() @{
|
|
TopHeader = "<HTML><HEAD>"
|
|
TopHeader = TopHeader \
|
|
"<title>My name is GAWK, GNU AWK</title></HEAD>"
|
|
TopDoc = "<BODY><h2>\
|
|
Do you prefer your date <A HREF=" MyPrefix \
|
|
"/human>human</A> or \
|
|
<A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS
|
|
TopFooter = "</BODY></HTML>"
|
|
@}
|
|
@end example
|
|
|
|
On the first run through the main loop, the default line terminators are
|
|
set and the default home page is copied to the actual home page. Since this
|
|
is the first run, @code{GETARG["Method"]} is not initialized yet, hence the
|
|
case selection over the method does nothing. Now that the home page is
|
|
initialized, the server can start communicating to a client browser.
|
|
|
|
@cindex RFC 2068
|
|
It does so by printing the HTTP header into the network connection
|
|
(@samp{print @dots{} |& HttpService}). This command blocks execution of
|
|
the server script until a client connects.
|
|
|
|
If you compare this server
|
|
script with the primitive one we wrote before, you will notice
|
|
two additional lines in the header. The first instructs the browser
|
|
to close the connection after each request. The second tells the
|
|
browser that it should never try to @emph{remember} earlier requests
|
|
that had identical web addresses (no caching). Otherwise, it could happen
|
|
that the browser retrieves the time of day in the previous example just once,
|
|
and later it takes the web page from the cache, always displaying the same
|
|
time of day although time advances each second.
|
|
|
|
Having supplied the initial home page to the browser with a valid document
|
|
stored in the parameter @code{Prompt}, it closes the connection and waits
|
|
for the next request. When the request comes, a log line is printed that
|
|
allows us to see which request the server receives. The final step in the
|
|
loop is to call the function @code{CGI_setup()}, which reads all the lines
|
|
of the request (coming from the browser), processes them, and stores the
|
|
transmitted parameters in the array @code{PARAM}. The complete
|
|
text of these application-independent functions can be found in
|
|
@ref{CGI Lib, ,A Simple CGI Library}.
|
|
For now, we use a simplified version of @code{CGI_setup()}:
|
|
|
|
@example
|
|
function CGI_setup( method, uri, version, i) @{
|
|
delete GETARG; delete MENU; delete PARAM
|
|
GETARG["Method"] = $1
|
|
GETARG["URI"] = $2
|
|
GETARG["Version"] = $3
|
|
i = index($2, "?")
|
|
# is there a "?" indicating a CGI request?
|
|
@group
|
|
if (i > 0) @{
|
|
split(substr($2, 1, i-1), MENU, "[/:]")
|
|
split(substr($2, i+1), PARAM, "&")
|
|
for (i in PARAM) @{
|
|
j = index(PARAM[i], "=")
|
|
GETARG[substr(PARAM[i], 1, j-1)] = \
|
|
substr(PARAM[i], j+1)
|
|
@}
|
|
@} else @{ # there is no "?", no need for splitting PARAMs
|
|
split($2, MENU, "[/:]")
|
|
@}
|
|
@end group
|
|
@}
|
|
@end example
|
|
|
|
At first, the function clears all variables used for
|
|
global storage of request parameters. The rest of the function serves
|
|
the purpose of filling the global parameters with the extracted new values.
|
|
To accomplish this, the name of the requested resource is split into
|
|
parts and stored for later evaluation. If the request contains a @samp{?},
|
|
then the request has CGI variables seamlessly appended to the web address.
|
|
Everything in front of the @samp{?} is split up into menu items, and
|
|
everything behind the @samp{?} is a list of @samp{@var{variable}=@var{value}} pairs
|
|
(separated by @samp{&}) that also need splitting. This way, CGI variables are
|
|
isolated and stored. This procedure lacks recognition of special characters
|
|
that are transmitted in coded form@footnote{As defined in RFC 2068.}. Here, any
|
|
optional request header and body parts are ignored. We do not need
|
|
header parameters and the request body. However, when refining our approach or
|
|
working with the @code{POST} and @code{PUT} methods, reading the header
|
|
and body
|
|
becomes inevitable. Header parameters should then be stored in a global
|
|
array as well as the body.
|
|
|
|
On each subsequent run through the main loop, one request from a browser is
|
|
received, evaluated, and answered according to the user's choice. This can be
|
|
done by letting the value of the HTTP method guide the main loop into
|
|
execution of the procedure @code{HandleGET()}, which evaluates the user's
|
|
choice. In this case, we have only one hierarchical level of menus,
|
|
but in the general case,
|
|
menus are nested.
|
|
The menu choices at each level are
|
|
separated by @samp{/}, just as in @value{FN}s. Notice how simple it is to
|
|
construct menus of arbitrary depth:
|
|
|
|
@example
|
|
function HandleGET() @{
|
|
if ( MENU[2] == "human") @{
|
|
Footer = strftime() TopFooter
|
|
@} else if (MENU[2] == "POSIX") @{
|
|
Footer = systime() TopFooter
|
|
@}
|
|
@}
|
|
@end example
|
|
|
|
The disadvantage of this approach is that our server is slow and can
|
|
handle only one request at a time. Its main advantage, however, is that
|
|
the server
|
|
consists of just one @command{gawk} program. No need for installing an
|
|
@command{httpd}, and no need for static separate HTML files, CGI scripts, or
|
|
@code{root} privileges. This is rapid prototyping.
|
|
This program can be started on the same host that runs your browser.
|
|
Then let your browser point to @uref{http://localhost:8080}.
|
|
|
|
@cindex XBM image format
|
|
@cindex images @subentry in web pages
|
|
@cindex web pages @subentry images in
|
|
@cindex GNUPlot utility
|
|
It is also possible to include images into the HTML pages.
|
|
Most browsers support the not very well-known
|
|
@file{.xbm} format,
|
|
which may contain only
|
|
monochrome pictures but is an ASCII format. Binary images are possible but
|
|
not so easy to handle. Another way of including images is to generate them
|
|
with a tool such as GNUPlot,
|
|
by calling the tool with the @code{system()} function or through a pipe.
|
|
|
|
@node CGI Lib, , Interacting Service, Interacting Service
|
|
@subsection A Simple CGI Library
|
|
@quotation
|
|
@i{HTTP is like being married: you have to be able to handle whatever
|
|
you're given, while being very careful what you send back.}@*
|
|
@author Phil Smith III,@* @uref{http://www.netfunny.com/rhf/jokes/99/Mar/http.html}
|
|
@end quotation
|
|
|
|
@cindex CGI (Common Gateway Interface) @subentry library
|
|
In @ref{Interacting Service, ,A Web Service with Interaction},
|
|
we saw the function @code{CGI_setup()} as part of the web server
|
|
``core logic'' framework. The code presented there handles almost
|
|
everything necessary for CGI requests.
|
|
One thing it doesn't do is handle encoded characters in the requests.
|
|
For example, an @samp{&} is encoded as a percent sign followed by
|
|
the hexadecimal value: @samp{%26}. These encoded values should be
|
|
decoded.
|
|
Following is a simple library to perform these tasks.
|
|
This code is used for all web server examples
|
|
throughout the rest of this @value{DOCUMENT}.
|
|
If you want to use it for your own web server, store the source code
|
|
into a file named @file{inetlib.awk}. Then you can include
|
|
these functions into your code by placing the following statement
|
|
into your program
|
|
(on the first line of your script):
|
|
|
|
@example
|
|
@@include inetlib.awk
|
|
@end example
|
|
|
|
@c FIXME: Needs revising, now that gawk has @include
|
|
@noindent
|
|
But beware, this mechanism is
|
|
only possible if you invoke your web server script with @command{igawk}
|
|
instead of the usual @command{awk} or @command{gawk}.
|
|
Here is the code:
|
|
|
|
@example
|
|
@c file eg/network/coreserv.awk
|
|
# CGI Library and core of a web server
|
|
@c endfile
|
|
@ignore
|
|
@c file eg/network/coreserv.awk
|
|
#
|
|
# Juergen Kahrs, Juergen.Kahrs@@vr-web.de
|
|
# with Arnold Robbins, arnold@@skeeve.com
|
|
# September 2000
|
|
|
|
@c endfile
|
|
@end ignore
|
|
@c file eg/network/coreserv.awk
|
|
# Global arrays
|
|
# GETARG --- arguments to CGI GET command
|
|
# MENU --- menu items (path names)
|
|
# PARAM --- parameters of form x=y
|
|
|
|
# Optional variable MyHost contains host address
|
|
# Optional variable MyPort contains port number
|
|
# Needs TopHeader, TopDoc, TopFooter
|
|
# Sets MyPrefix, HttpService, Status, Reason
|
|
|
|
BEGIN @{
|
|
if (MyHost == "") @{
|
|
"uname -n" | getline MyHost
|
|
close("uname -n")
|
|
@}
|
|
if (MyPort == 0) MyPort = 8080
|
|
HttpService = "/inet/tcp/" MyPort "/0/0"
|
|
MyPrefix = "http://" MyHost ":" MyPort
|
|
SetUpServer()
|
|
while ("awk" != "complex") @{
|
|
# header lines are terminated this way
|
|
RS = ORS = "\r\n"
|
|
Status = 200 # this means OK
|
|
Reason = "OK"
|
|
Header = TopHeader
|
|
Document = TopDoc
|
|
Footer = TopFooter
|
|
if (GETARG["Method"] == "GET") @{
|
|
HandleGET()
|
|
@} else if (GETARG["Method"] == "HEAD") @{
|
|
# not yet implemented
|
|
@} else if (GETARG["Method"] != "") @{
|
|
print "bad method", GETARG["Method"]
|
|
@}
|
|
Prompt = Header Document Footer
|
|
print "HTTP/1.0", Status, Reason |& HttpService
|
|
print "Connection: Close" |& HttpService
|
|
print "Pragma: no-cache" |& HttpService
|
|
len = length(Prompt) + length(ORS)
|
|
print "Content-length:", len |& HttpService
|
|
print ORS Prompt |& HttpService
|
|
# ignore all the header lines
|
|
while ((HttpService |& getline) > 0)
|
|
continue
|
|
# stop talking to this client
|
|
close(HttpService)
|
|
# wait for new client request
|
|
HttpService |& getline
|
|
# do some logging
|
|
print systime(), strftime(), $0
|
|
CGI_setup($1, $2, $3)
|
|
@}
|
|
@}
|
|
|
|
function CGI_setup(method, uri, version, i)
|
|
@{
|
|
delete GETARG
|
|
delete MENU
|
|
delete PARAM
|
|
GETARG["Method"] = method
|
|
GETARG["URI"] = uri
|
|
GETARG["Version"] = version
|
|
|
|
i = index(uri, "?")
|
|
if (i > 0) @{ # is there a "?" indicating a CGI request?
|
|
split(substr(uri, 1, i-1), MENU, "[/:]")
|
|
split(substr(uri, i+1), PARAM, "&")
|
|
for (i in PARAM) @{
|
|
PARAM[i] = _CGI_decode(PARAM[i])
|
|
j = index(PARAM[i], "=")
|
|
GETARG[substr(PARAM[i], 1, j-1)] = \
|
|
substr(PARAM[i], j+1)
|
|
@}
|
|
@} else @{ # there is no "?", no need for splitting PARAMs
|
|
split(uri, MENU, "[/:]")
|
|
@}
|
|
for (i in MENU) # decode characters in path
|
|
if (i > 4) # but not those in host name
|
|
MENU[i] = _CGI_decode(MENU[i])
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
This isolates details in a single function, @code{CGI_setup()}.
|
|
Decoding of encoded characters is pushed off to a helper function,
|
|
@code{_CGI_decode()}. The use of the leading underscore (@samp{_}) in
|
|
the function name is intended to indicate that it is an ``internal''
|
|
function, although there is nothing to enforce this:
|
|
|
|
@example
|
|
@c file eg/network/coreserv.awk
|
|
function _CGI_decode(str, hexdigs, i, pre, code1, code2,
|
|
val, result)
|
|
@{
|
|
hexdigs = "123456789abcdef"
|
|
|
|
i = index(str, "%")
|
|
if (i == 0) # no work to do
|
|
return str
|
|
|
|
do @{
|
|
pre = substr(str, 1, i-1) # part before %xx
|
|
code1 = substr(str, i+1, 1) # first hex digit
|
|
code2 = substr(str, i+2, 1) # second hex digit
|
|
str = substr(str, i+3) # rest of string
|
|
|
|
code1 = tolower(code1)
|
|
code2 = tolower(code2)
|
|
val = index(hexdigs, code1) * 16 \
|
|
+ index(hexdigs, code2)
|
|
|
|
result = result pre sprintf("%c", val)
|
|
i = index(str, "%")
|
|
@} while (i != 0)
|
|
if (length(str) > 0)
|
|
result = result str
|
|
return result
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
This works by splitting the string apart around an encoded character.
|
|
The two digits are converted to lowercase characters and looked up in a string
|
|
of hex digits. Note that @code{0} is not in the string on purpose;
|
|
@code{index()} returns zero when it's not found, automatically giving
|
|
the correct value! Once the hexadecimal value is converted from
|
|
characters in a string into a numerical value, @code{sprintf()}
|
|
converts the value back into a real character.
|
|
The following is a simple test harness for the above functions:
|
|
|
|
@example
|
|
@c file eg/network/testserv.awk
|
|
BEGIN @{
|
|
CGI_setup("GET",
|
|
"http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
|
|
"&percent=a %25 sign",
|
|
"1.0")
|
|
for (i in MENU)
|
|
printf "MENU[\"%s\"] = %s\n", i, MENU[i]
|
|
for (i in PARAM)
|
|
printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
|
|
for (i in GETARG)
|
|
printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@c FIXME: Rerun to make sure still correct
|
|
And this is the result when we run it:
|
|
|
|
@c artificial line wrap in last output line
|
|
@example
|
|
$ gawk -f testserv.awk
|
|
@print{} MENU["4"] = www.gnu.org
|
|
@print{} MENU["5"] = cgi-bin
|
|
@print{} MENU["6"] = foo
|
|
@print{} MENU["1"] = http
|
|
@print{} MENU["2"] =
|
|
@print{} MENU["3"] =
|
|
@print{} PARAM["1"] = p1=stuff
|
|
@print{} PARAM["2"] = p2=stuff&junk
|
|
@print{} PARAM["3"] = percent=a % sign
|
|
@print{} GETARG["p1"] = stuff
|
|
@print{} GETARG["percent"] = a % sign
|
|
@print{} GETARG["p2"] = stuff&junk
|
|
@print{} GETARG["Method"] = GET
|
|
@print{} GETARG["Version"] = 1.0
|
|
@print{} GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&
|
|
p2=stuff%26junk&percent=a %25 sign
|
|
@end example
|
|
|
|
@node Simple Server, Caveats, Interacting Service, Using Networking
|
|
@section A Simple Web Server
|
|
@cindex web servers
|
|
@cindex servers @subentry web
|
|
In the preceding @value{SECTION}, we built the core logic for event-driven GUIs.
|
|
In this @value{SECTION}, we finally extend the core to a real application.
|
|
No one would actually write a commercial web server in @command{gawk}, but
|
|
it is instructive to see that it is feasible in principle.
|
|
|
|
@cindex ELIZA program
|
|
@cindex Weizenbaum, Joseph
|
|
The application is ELIZA, the famous program by Joseph Weizenbaum that
|
|
mimics the behavior of a professional psychotherapist when talking to you.
|
|
Weizenbaum would certainly object to this description, but this is part of
|
|
the legend around ELIZA.
|
|
Take the site-independent core logic and append the following code:
|
|
|
|
@example
|
|
@c file eg/network/eliza.awk
|
|
function SetUpServer() @{
|
|
SetUpEliza()
|
|
TopHeader = \
|
|
"<HTML><title>An HTTP-based System with GAWK</title>\
|
|
<HEAD><META HTTP-EQUIV=\"Content-Type\"\
|
|
CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\
|
|
<BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\"\
|
|
LINK=\"#0000ff\" VLINK=\"#0000ff\"\
|
|
ALINK=\"#0000ff\"> <A NAME=\"top\">"
|
|
TopDoc = "\
|
|
<h2>Please choose one of the following actions:</h2>\
|
|
<UL>\
|
|
<LI>\
|
|
<A HREF=" MyPrefix "/AboutServer>About this server</A>\
|
|
</LI><LI>\
|
|
<A HREF=" MyPrefix "/AboutELIZA>About Eliza</A></LI>\
|
|
<LI>\
|
|
<A HREF=" MyPrefix \
|
|
"/StartELIZA>Start talking to Eliza</A></LI></UL>"
|
|
TopFooter = "</BODY></HTML>"
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@code{SetUpServer()} is similar to the previous example,
|
|
except for calling another function, @code{SetUpEliza()}.
|
|
This approach can be used to implement other kinds of servers.
|
|
The only changes needed to do so are hidden in the functions
|
|
@code{SetUpServer()} and @code{HandleGET()}. Perhaps it might be necessary to
|
|
implement other HTTP methods.
|
|
@c FIXME: @include?
|
|
The @command{igawk} program that comes with @command{gawk}
|
|
may be useful for this process.
|
|
|
|
When extending this example to a complete application, the first
|
|
thing to do is to implement the function @code{SetUpServer()} to
|
|
initialize the HTML pages and some variables. These initializations
|
|
determine the way your HTML pages look (colors, titles, menu
|
|
items, etc.).
|
|
|
|
The function @code{HandleGET()} is a nested case selection that decides
|
|
which page the user wants to see next. Each nesting level refers to a menu
|
|
level of the GUI. Each case implements a certain action of the menu. At the
|
|
deepest level of case selection, the handler essentially knows what the
|
|
user wants and stores the answer into the variable that holds the HTML
|
|
page contents:
|
|
|
|
@smallexample
|
|
@c file eg/network/eliza.awk
|
|
function HandleGET() @{
|
|
# A real HTTP server would treat some parts of the URI as a file name.
|
|
# We take parts of the URI as menu choices and go on accordingly.
|
|
if (MENU[2] == "AboutServer") @{
|
|
Document = "This is not a CGI script.\
|
|
This is an httpd, an HTML file, and a CGI script all \
|
|
in one GAWK script. It needs no separate www-server, \
|
|
no installation, and no root privileges.\
|
|
<p>To run it, do this:</p><ul>\
|
|
<li> start this script with \"gawk -f httpserver.awk\",</li>\
|
|
<li> and on the same host let your www browser open location\
|
|
\"http://localhost:8080\"</li>\
|
|
</ul>\<p>\ Details of HTTP come from:</p><ul>\
|
|
<li>Hethmon: Illustrated Guide to HTTP</p>\
|
|
<li>RFC 2068</li></ul><p>JK 14.9.1997</p>"
|
|
@} else if (MENU[2] == "AboutELIZA") @{
|
|
Document = "This is an implementation of the famous ELIZA\
|
|
program by Joseph Weizenbaum. It is written in GAWK and\
|
|
uses an HTML GUI."
|
|
@} else if (MENU[2] == "StartELIZA") @{
|
|
gsub(/\+/, " ", GETARG["YouSay"])
|
|
# Here we also have to substitute coded special characters
|
|
Document = "<form method=GET>" \
|
|
"<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\
|
|
<p><input type=text name=YouSay value=\"\" size=60>\
|
|
<br><input type=submit value=\"Tell her about it\"></p></form>"
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Now we are down to the heart of ELIZA, so you can see how it works.
|
|
Initially the user does not say anything; then ELIZA resets its money
|
|
counter and asks the user to tell what comes to mind open-heartedly.
|
|
The subsequent answers are converted to uppercase characters and stored for
|
|
later comparison. ELIZA presents the bill when being confronted with
|
|
a sentence that contains the phrase ``shut up.'' Otherwise, it looks for
|
|
keywords in the sentence, conjugates the rest of the sentence, remembers
|
|
the keyword for later use, and finally selects an answer from the set of
|
|
possible answers:
|
|
|
|
@smallexample
|
|
@c file eg/network/eliza.awk
|
|
function ElizaSays(YouSay) @{
|
|
if (YouSay == "") @{
|
|
cost = 0
|
|
answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
|
|
@} else @{
|
|
q = toupper(YouSay)
|
|
gsub("'", "", q)
|
|
if (q == qold) @{
|
|
answer = "PLEASE DONT REPEAT YOURSELF !"
|
|
@} else @{
|
|
if (index(q, "SHUT UP") > 0) @{
|
|
answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
|
|
int(100*rand()+30+cost/100)
|
|
@} else @{
|
|
qold = q
|
|
w = "-" # no keyword recognized yet
|
|
for (i in k) @{ # search for keywords
|
|
if (index(q, i) > 0) @{
|
|
w = i
|
|
break
|
|
@}
|
|
@}
|
|
if (w == "-") @{ # no keyword, take old subject
|
|
w = wold
|
|
subj = subjold
|
|
@} else @{ # find subject
|
|
subj = substr(q, index(q, w) + length(w)+1)
|
|
wold = w
|
|
subjold = subj # remember keyword and subject
|
|
@}
|
|
for (i in conj)
|
|
gsub(i, conj[i], q) # conjugation
|
|
# from all answers to this keyword, select one randomly
|
|
answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
|
|
# insert subject into answer
|
|
gsub("_", subj, answer)
|
|
@}
|
|
@}
|
|
@}
|
|
cost += length(answer) # for later payment : 1 cent per character
|
|
return answer
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
In the long but simple function @code{SetUpEliza()}, you can see tables
|
|
for conjugation, keywords, and answers.@footnote{The version shown
|
|
here is abbreviated. The full version comes with the @command{gawk}
|
|
distribution.} The associative array @code{k}
|
|
contains indices into the array of answers @code{r}. To choose an
|
|
answer, ELIZA just picks an index randomly:
|
|
|
|
@example
|
|
@c file eg/network/eliza.awk
|
|
function SetUpEliza() @{
|
|
srand()
|
|
wold = "-"
|
|
subjold = " "
|
|
|
|
# table for conjugation
|
|
conj[" ARE " ] = " AM "
|
|
conj["WERE " ] = "WAS "
|
|
conj[" YOU " ] = " I "
|
|
conj["YOUR " ] = "MY "
|
|
conj[" IVE " ] =\
|
|
conj[" I HAVE " ] = " YOU HAVE "
|
|
conj[" YOUVE " ] =\
|
|
conj[" YOU HAVE "] = " I HAVE "
|
|
conj[" IM " ] =\
|
|
conj[" I AM " ] = " YOU ARE "
|
|
conj[" YOURE " ] =\
|
|
conj[" YOU ARE " ] = " I AM "
|
|
|
|
# table of all answers
|
|
r[1] = "DONT YOU BELIEVE THAT I CAN _"
|
|
r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
|
|
@c endfile
|
|
@dots{}
|
|
@end example
|
|
@ignore
|
|
@c file eg/network/eliza.awk
|
|
r[3] = "YOU WANT ME TO BE ABLE TO _ ?"
|
|
r[4] = "PERHAPS YOU DONT WANT TO _ "
|
|
r[5] = "DO YOU WANT TO BE ABLE TO _ ?"
|
|
r[6] = "WHAT MAKES YOU THINK I AM _ ?"
|
|
r[7] = "DOES IT PLEASE YOU TO BELIEVE I AM _ ?"
|
|
r[8] = "PERHAPS YOU WOULD LIKE TO BE _ ?"
|
|
r[9] = "DO YOU SOMETIMES WISH YOU WERE _ ?"
|
|
r[10] = "DONT YOU REALLY _ ?"
|
|
r[11] = "WHY DONT YOU _ ?"
|
|
r[12] = "DO YOU WISH TO BE ABLE TO _ ?"
|
|
r[13] = "DOES THAT TROUBLE YOU ?"
|
|
r[14] = "TELL ME MORE ABOUT SUCH FEELINGS"
|
|
r[15] = "DO YOU OFTEN FEEL _ ?"
|
|
r[16] = "DO YOU ENJOY FEELING _ ?"
|
|
r[17] = "DO YOU REALLY BELIEVE I DONT _ ?"
|
|
r[18] = "PERHAPS IN GOOD TIME I WILL _ "
|
|
r[19] = "DO YOU WANT ME TO _ ?"
|
|
r[20] = "DO YOU THINK YOU SHOULD BE ABLE TO _ ?"
|
|
r[21] = "WHY CANT YOU _ ?"
|
|
r[22] = "WHY ARE YOU INTERESTED IN WHETHER OR NOT I AM _ ?"
|
|
r[23] = "WOULD YOU PREFER IF I WERE NOT _ ?"
|
|
r[24] = "PERHAPS IN YOUR FANTASIES I AM _ "
|
|
r[25] = "HOW DO YOU KNOW YOU CANT _ ?"
|
|
r[26] = "HAVE YOU TRIED ?"
|
|
r[27] = "PERHAPS YOU CAN NOW _ "
|
|
r[28] = "DID YOU COME TO ME BECAUSE YOU ARE _ ?"
|
|
r[29] = "HOW LONG HAVE YOU BEEN _ ?"
|
|
r[30] = "DO YOU BELIEVE ITS NORMAL TO BE _ ?"
|
|
r[31] = "DO YOU ENJOY BEING _ ?"
|
|
r[32] = "WE WERE DISCUSSING YOU -- NOT ME"
|
|
r[33] = "Oh, I _"
|
|
r[34] = "YOU'RE NOT REALLY TALKING ABOUT ME, ARE YOU ?"
|
|
r[35] = "WHAT WOULD IT MEAN TO YOU, IF YOU GOT _ ?"
|
|
r[36] = "WHY DO YOU WANT _ ?"
|
|
r[37] = "SUPPOSE YOU SOON GOT _"
|
|
r[38] = "WHAT IF YOU NEVER GOT _ ?"
|
|
r[39] = "I SOMETIMES ALSO WANT _"
|
|
r[40] = "WHY DO YOU ASK ?"
|
|
r[41] = "DOES THAT QUESTION INTEREST YOU ?"
|
|
r[42] = "WHAT ANSWER WOULD PLEASE YOU THE MOST ?"
|
|
r[43] = "WHAT DO YOU THINK ?"
|
|
r[44] = "ARE SUCH QUESTIONS IN YOUR MIND OFTEN ?"
|
|
r[45] = "WHAT IS IT THAT YOU REALLY WANT TO KNOW ?"
|
|
r[46] = "HAVE YOU ASKED ANYONE ELSE ?"
|
|
r[47] = "HAVE YOU ASKED SUCH QUESTIONS BEFORE ?"
|
|
r[48] = "WHAT ELSE COMES TO MIND WHEN YOU ASK THAT ?"
|
|
r[49] = "NAMES DON'T INTEREST ME"
|
|
r[50] = "I DONT CARE ABOUT NAMES -- PLEASE GO ON"
|
|
r[51] = "IS THAT THE REAL REASON ?"
|
|
r[52] = "DONT ANY OTHER REASONS COME TO MIND ?"
|
|
r[53] = "DOES THAT REASON EXPLAIN ANYTHING ELSE ?"
|
|
r[54] = "WHAT OTHER REASONS MIGHT THERE BE ?"
|
|
r[55] = "PLEASE DON'T APOLOGIZE !"
|
|
r[56] = "APOLOGIES ARE NOT NECESSARY"
|
|
r[57] = "WHAT FEELINGS DO YOU HAVE WHEN YOU APOLOGIZE ?"
|
|
r[58] = "DON'T BE SO DEFENSIVE"
|
|
r[59] = "WHAT DOES THAT DREAM SUGGEST TO YOU ?"
|
|
r[60] = "DO YOU DREAM OFTEN ?"
|
|
r[61] = "WHAT PERSONS APPEAR IN YOUR DREAMS ?"
|
|
r[62] = "ARE YOU DISTURBED BY YOUR DREAMS ?"
|
|
r[63] = "HOW DO YOU DO ... PLEASE STATE YOUR PROBLEM"
|
|
r[64] = "YOU DON'T SEEM QUITE CERTAIN"
|
|
r[65] = "WHY THE UNCERTAIN TONE ?"
|
|
r[66] = "CAN'T YOU BE MORE POSITIVE ?"
|
|
r[67] = "YOU AREN'T SURE ?"
|
|
r[68] = "DON'T YOU KNOW ?"
|
|
r[69] = "WHY NO _ ?"
|
|
r[70] = "DON'T SAY NO, IT'S ALWAYS SO NEGATIVE"
|
|
r[71] = "WHY NOT ?"
|
|
r[72] = "ARE YOU SURE ?"
|
|
r[73] = "WHY NO ?"
|
|
r[74] = "WHY ARE YOU CONCERNED ABOUT MY _ ?"
|
|
r[75] = "WHAT ABOUT YOUR OWN _ ?"
|
|
r[76] = "CAN'T YOU THINK ABOUT A SPECIFIC EXAMPLE ?"
|
|
r[77] = "WHEN ?"
|
|
r[78] = "WHAT ARE YOU THINKING OF ?"
|
|
r[79] = "REALLY, ALWAYS ?"
|
|
r[80] = "DO YOU REALLY THINK SO ?"
|
|
r[81] = "BUT YOU ARE NOT SURE YOU _ "
|
|
r[82] = "DO YOU DOUBT YOU _ ?"
|
|
r[83] = "IN WHAT WAY ?"
|
|
r[84] = "WHAT RESEMBLANCE DO YOU SEE ?"
|
|
r[85] = "WHAT DOES THE SIMILARITY SUGGEST TO YOU ?"
|
|
r[86] = "WHAT OTHER CONNECTION DO YOU SEE ?"
|
|
r[87] = "COULD THERE REALLY BE SOME CONNECTIONS ?"
|
|
r[88] = "HOW ?"
|
|
r[89] = "YOU SEEM QUITE POSITIVE"
|
|
r[90] = "ARE YOU SURE ?"
|
|
r[91] = "I SEE"
|
|
r[92] = "I UNDERSTAND"
|
|
r[93] = "WHY DO YOU BRING UP THE TOPIC OF FRIENDS ?"
|
|
r[94] = "DO YOUR FRIENDS WORRY YOU ?"
|
|
r[95] = "DO YOUR FRIENDS PICK ON YOU ?"
|
|
r[96] = "ARE YOU SURE YOU HAVE ANY FRIENDS ?"
|
|
r[97] = "DO YOU IMPOSE ON YOUR FRIENDS ?"
|
|
r[98] = "PERHAPS YOUR LOVE FOR FRIENDS WORRIES YOU"
|
|
r[99] = "DO COMPUTERS WORRY YOU ?"
|
|
r[100] = "ARE YOU TALKING ABOUT ME IN PARTICULAR ?"
|
|
r[101] = "ARE YOU FRIGHTENED BY MACHINES ?"
|
|
r[102] = "WHY DO YOU MENTION COMPUTERS ?"
|
|
r[103] = "WHAT DO YOU THINK MACHINES HAVE TO DO WITH YOUR PROBLEMS ?"
|
|
r[104] = "DON'T YOU THINK COMPUTERS CAN HELP PEOPLE ?"
|
|
r[105] = "WHAT IS IT ABOUT MACHINES THAT WORRIES YOU ?"
|
|
r[106] = "SAY, DO YOU HAVE ANY PSYCHOLOGICAL PROBLEMS ?"
|
|
r[107] = "WHAT DOES THAT SUGGEST TO YOU ?"
|
|
r[108] = "I SEE"
|
|
r[109] = "IM NOT SURE I UNDERSTAND YOU FULLY"
|
|
r[110] = "COME COME ELUCIDATE YOUR THOUGHTS"
|
|
r[111] = "CAN YOU ELABORATE ON THAT ?"
|
|
r[112] = "THAT IS QUITE INTERESTING"
|
|
r[113] = "WHY DO YOU HAVE PROBLEMS WITH MONEY ?"
|
|
r[114] = "DO YOU THINK MONEY IS EVERYTHING ?"
|
|
r[115] = "ARE YOU SURE THAT MONEY IS THE PROBLEM ?"
|
|
r[116] = "I THINK WE WANT TO TALK ABOUT YOU, NOT ABOUT ME"
|
|
r[117] = "WHAT'S ABOUT ME ?"
|
|
r[118] = "WHY DO YOU ALWAYS BRING UP MY NAME ?"
|
|
@c endfile
|
|
@end ignore
|
|
|
|
@example
|
|
@c file eg/network/eliza.awk
|
|
# table for looking up answers that
|
|
# fit to a certain keyword
|
|
k["CAN YOU"] = "1 2 3"
|
|
k["CAN I"] = "4 5"
|
|
k["YOU ARE"] =\
|
|
k["YOURE"] = "6 7 8 9"
|
|
@c endfile
|
|
@dots{}
|
|
@end example
|
|
@ignore
|
|
@c file eg/network/eliza.awk
|
|
k["I DONT"] = "10 11 12 13"
|
|
k["I FEEL"] = "14 15 16"
|
|
k["WHY DONT YOU"] = "17 18 19"
|
|
k["WHY CANT I"] = "20 21"
|
|
k["ARE YOU"] = "22 23 24"
|
|
k["I CANT"] = "25 26 27"
|
|
k["I AM"] =\
|
|
k["IM "] = "28 29 30 31"
|
|
k["YOU "] = "32 33 34"
|
|
k["I WANT"] = "35 36 37 38 39"
|
|
k["WHAT"] =\
|
|
k["HOW"] =\
|
|
k["WHO"] =\
|
|
k["WHERE"] =\
|
|
k["WHEN"] =\
|
|
k["WHY"] = "40 41 42 43 44 45 46 47 48"
|
|
k["NAME"] = "49 50"
|
|
k["CAUSE"] = "51 52 53 54"
|
|
k["SORRY"] = "55 56 57 58"
|
|
k["DREAM"] = "59 60 61 62"
|
|
k["HELLO"] =\
|
|
k["HI "] = "63"
|
|
k["MAYBE"] = "64 65 66 67 68"
|
|
k[" NO "] = "69 70 71 72 73"
|
|
k["YOUR"] = "74 75"
|
|
k["ALWAYS"] = "76 77 78 79"
|
|
k["THINK"] = "80 81 82"
|
|
k["LIKE"] = "83 84 85 86 87 88 89"
|
|
k["YES"] = "90 91 92"
|
|
k["FRIEND"] = "93 94 95 96 97 98"
|
|
k["COMPUTER"] = "99 100 101 102 103 104 105"
|
|
k["-"] = "106 107 108 109 110 111 112"
|
|
k["MONEY"] = "113 114 115"
|
|
k["ELIZA"] = "116 117 118"
|
|
@c endfile
|
|
@end ignore
|
|
@example
|
|
@c file eg/network/eliza.awk
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@cindex Humphrys, Mark
|
|
@cindex ELIZA program
|
|
Some interesting remarks and details (including the original source code
|
|
of ELIZA) are found on Mark Humphrys's home page
|
|
@uref{https://computing.dcu.ie/~humphrys/eliza.html,
|
|
@cite{How my program passed the Turing Test}}.
|
|
Wikipedia provides much background information about
|
|
@uref{https://en.wikipedia.org/wiki/ELIZA, ELIZA},
|
|
including the original design of the software and
|
|
its early implementations.
|
|
|
|
@node Caveats, Challenges, Simple Server, Using Networking
|
|
@section Network Programming Caveats
|
|
|
|
@cindex networks @subentry @command{gawk} and @subentry troubleshooting
|
|
@cindex @command{gawk} @subentry networking @subentry troubleshooting
|
|
@cindex troubleshooting @subentry @command{gawk}, networks
|
|
By now it should be clear
|
|
that debugging a networked application is more
|
|
complicated than debugging a single-process single-hosted application.
|
|
The behavior of a networked application sometimes looks noncausal because
|
|
it is not reproducible in a strong sense. Whether a network application
|
|
works or not sometimes depends on the following:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
How crowded the underlying network is
|
|
|
|
@item
|
|
If the party at the other end is running or not
|
|
|
|
@item
|
|
The state of the party at the other end
|
|
@end itemize
|
|
|
|
@cindex troubleshooting @subentry networks @subentry timeouts
|
|
The most difficult problems for a beginner arise from the hidden states of the
|
|
underlying network. After closing a TCP connection, it's often necessary to wait
|
|
a short while before reopening the connection. Even more difficult is the
|
|
establishment of a connection that previously ended with a ``broken pipe.''
|
|
Those connections have to ``time out'' for a minute or so
|
|
before they can reopen.
|
|
Check this with the command @samp{netstat -a}, which
|
|
provides a list of still-active connections.
|
|
|
|
@node Challenges, , Caveats, Using Networking
|
|
@section Where To Go From Here
|
|
|
|
@cindex Loebner, Hugh
|
|
@cindex contest
|
|
Now, you have learned enough to build your own application. You could,
|
|
for example, take part in the
|
|
Loebner Contest
|
|
to win $100,000. The Loebner Prize is the first formal instantiation of
|
|
a Turing Test. Hugh Loebner agreed with The Cambridge Center for Behavioral
|
|
Studies to underwrite a contest designed to implement the Turing Test.
|
|
Dr.@: Loebner pledged a Grand Prize of $100,000 for the first computer whose
|
|
responses were indistinguishable from a human's. Each year an annual prize
|
|
of $2000 and a bronze medal is awarded to the @emph{most} human computer.
|
|
The winner of the annual contest is the best entry relative to other entries
|
|
that year, irrespective of how good it is in an absolute sense. Here is
|
|
an example of a conversation with the winning program of 1997:
|
|
|
|
@smallexample
|
|
(c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
|
|
[Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
|
|
PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
|
|
JUDGE02[10:39:36]My name is Nathan.
|
|
PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
|
|
PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
|
|
PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
|
|
JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
|
|
PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
|
|
PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
|
|
PROGRAM[10:41:21]embarrassed?
|
|
JUDGE02[10:41:37]You tell me. I didn't see it.
|
|
PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
|
|
JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
|
|
PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
|
|
PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
|
|
PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
|
|
JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
|
|
PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
|
|
PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
|
|
PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
|
|
PROGRAM[10:44:01]dramatic actually happen?
|
|
JUDGE02[10:44:19]Do you know what sculpture is?
|
|
PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
|
|
PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
|
|
PROGRAM[10:44:51]must say.
|
|
JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
|
|
PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
|
|
PROGRAM[10:45:43]off this one I think and onto something more down to earth!
|
|
JUDGE02[10:46:20]What is more down to earth than art?
|
|
PROGRAM[10:46:21]I don't know what -- to be honest. -
|
|
PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
|
|
PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
|
|
PROGRAM[10:47:03]man? "
|
|
JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
|
|
JUDGE02[10:48:10]from another play the name of which I cannot remember.
|
|
PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
|
|
JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
|
|
PROGRAM[10:49:02]Do you think of yourself as being attractive?
|
|
@end smallexample
|
|
|
|
@cindex Clinton, Bill
|
|
This program insists on always speaking about the same story around Bill
|
|
Clinton. You see, even a program with a rather narrow mind can behave so
|
|
much like a human being that it can win this prize. It is quite common to
|
|
let these programs talk to each other via network connections. But during the
|
|
competition itself, the program and its computer have to be present at the
|
|
place the competition is held. We all would love to see a @command{gawk}
|
|
program win in such an event. Maybe it is up to you to accomplish this?
|
|
|
|
Some other ideas for useful networked applications:
|
|
@itemize @bullet
|
|
@item
|
|
Read the file @file{doc/awkforai.txt} in earlier @command{gawk}
|
|
distributions.@footnote{The file is no longer distributed with
|
|
@command{gawk}, since the copyright on the file is not clear.}
|
|
It was written by Ronald P.@: Loui (at the time, Associate
|
|
Professor of Computer Science, at Washington University in St. Louis,
|
|
@email{loui@@ai.wustl.edu}) and summarizes why he taught @command{gawk} to
|
|
students of Artificial Intelligence. Here are some passages from the text:
|
|
|
|
@cindex AI
|
|
@cindex PROLOG
|
|
@cindex Loui, Ronald
|
|
@cindex agent
|
|
@quotation
|
|
The GAWK manual can
|
|
be consumed in a single lab session and the language can be mastered by
|
|
the next morning by the average student. GAWK's automatic
|
|
initialization, implicit coercion, I/O support and lack of pointers
|
|
forgive many of the mistakes that young programmers are likely to make.
|
|
Those who have seen C but not mastered it are happy to see that GAWK
|
|
retains some of the same sensibilities while adding what must be
|
|
regarded as spoonsful of syntactic sugar.@*
|
|
@dots{}@*
|
|
@cindex robot
|
|
There are further simple answers. Probably the best is the fact that
|
|
increasingly, undergraduate AI programming is involving the Web. Oren
|
|
Etzioni (University of Washington, Seattle) has for a while been arguing
|
|
that the ``softbot'' is replacing the mechanical engineers' robot as the
|
|
most glamorous AI testbed. If the artifact whose behavior needs to be
|
|
controlled in an intelligent way is the software agent, then a language
|
|
that is well-suited to controlling the software environment is the
|
|
appropriate language. That would imply a scripting language. If the
|
|
robot is KAREL, then the right language is ``turn left; turn right.'' If
|
|
the robot is Netscape, then the right language is something that can
|
|
generate @samp{netscape -remote 'openURL(http://cs.wustl.edu/~loui)'} with
|
|
elan.@*
|
|
@dots{}@*
|
|
AI programming requires high-level thinking. There have always been a few
|
|
gifted programmers who can write high-level programs in assembly language.
|
|
Most however need the ambient abstraction to have a higher floor.@*
|
|
@dots{}@*
|
|
Second, inference is merely the expansion of notation. No matter whether
|
|
the logic that underlies an AI program is fuzzy, probabilistic, deontic,
|
|
defeasible, or deductive, the logic merely defines how strings can be
|
|
transformed into other strings. A language that provides the best
|
|
support for string processing in the end provides the best support for
|
|
logic, for the exploration of various logics, and for most forms of
|
|
symbolic processing that AI might choose to call ``reasoning'' instead of
|
|
``logic.'' The implication is that PROLOG, which saves the AI programmer
|
|
from having to write a unifier, saves perhaps two dozen lines of GAWK
|
|
code at the expense of strongly biasing the logic and representational
|
|
expressiveness of any approach.
|
|
@end quotation
|
|
|
|
Now that @command{gawk} itself can connect to the Internet, it should be obvious
|
|
that it is suitable for writing intelligent web agents.
|
|
|
|
@item
|
|
@command{awk} is strong at pattern recognition and string processing.
|
|
So, it is well suited to the classic problem of language translation.
|
|
A first try could be a program that knows the 100 most frequent English
|
|
words and their counterparts in German or French. The service could be
|
|
implemented by regularly reading email with the program above, replacing
|
|
each word by its translation and sending the translation back via SMTP.
|
|
Users would send English email to their translation service and get
|
|
back a translated email message in return. As soon as this works,
|
|
more effort can be spent on a real translation program.
|
|
|
|
@item
|
|
Another dialogue-oriented application (on the verge
|
|
of ridicule) is the email ``support service.'' Troubled customers write an
|
|
email to an automatic @command{gawk} service that reads the email. It looks
|
|
for keywords in the mail and assembles a reply email accordingly. By carefully
|
|
investigating the email header, and repeating these keywords through the
|
|
reply email, it is rather simple to give the customer a feeling that
|
|
someone cares. Ideally, such a service would search a database of previous
|
|
cases for solutions. If none exists, the database could, for example, consist
|
|
of all the newsgroups, mailing lists and FAQs on the Internet.
|
|
@end itemize
|
|
|
|
@node Some Applications and Techniques, Links, Using Networking, Top
|
|
@comment node-name, next, previous, up
|
|
|
|
@chapter Some Applications and Techniques
|
|
In this @value{CHAPTER}, we look at a number of self-contained
|
|
scripts, with an emphasis on concise networking. Along the way, we
|
|
work towards creating building blocks that encapsulate often-needed
|
|
functions of the networking world, show new techniques that
|
|
broaden the scope of problems that can be solved with @command{gawk}, and
|
|
explore leading edge technology that may shape the future of networking.
|
|
|
|
We often refer to the site-independent core of the server that
|
|
we built in
|
|
@ref{Simple Server, ,A Simple Web Server}.
|
|
When building new and nontrivial servers, we
|
|
always copy this building block and append new instances of the two
|
|
functions @code{SetUpServer()} and @code{HandleGET()}.
|
|
|
|
This makes a lot of sense, since
|
|
this scheme of event-driven
|
|
execution provides @command{gawk} with an interface to the most widely
|
|
accepted standard for GUIs: the web browser. Now, @command{gawk} can rival even
|
|
Tcl/Tk.
|
|
|
|
@cindex Tcl/Tk @subentry @command{gawk} and
|
|
Tcl and @command{gawk} have much in common. Both are simple scripting
|
|
languages that allow us to quickly solve problems with short programs. But
|
|
Tcl has Tk on top of it, and @command{gawk} had nothing comparable up
|
|
to now. While Tcl needs a large and ever-changing library (Tk, which was
|
|
originally bound to the X Window System), @command{gawk} needs just the
|
|
networking interface
|
|
and some kind of browser on the client's side. Besides better portability,
|
|
the most important advantage of this approach (embracing well-established
|
|
standards such HTTP and HTML) is that @emph{we do not need to change the
|
|
language}. We let others do the work of fighting over protocols and standards.
|
|
We can use HTML, JavaScript, VRML, or whatever else comes along to do our work.
|
|
|
|
@menu
|
|
* PANIC:: An Emergency Web Server.
|
|
* GETURL:: Retrieving Web Pages.
|
|
* REMCONF:: Remote Configuration Of Embedded Systems.
|
|
* URLCHK:: Look For Changed Web Pages.
|
|
* WEBGRAB:: Extract Links From A Page.
|
|
* STATIST:: Graphing A Statistical Distribution.
|
|
* MAZE:: Walking Through A Maze In Virtual Reality.
|
|
* MOBAGWHO:: A Simple Mobile Agent.
|
|
* STOXPRED:: Stock Market Prediction As A Service.
|
|
* PROTBASE:: Searching Through A Protein Database.
|
|
@end menu
|
|
|
|
@node PANIC, GETURL, Some Applications and Techniques, Some Applications and Techniques
|
|
@section PANIC: An Emergency Web Server
|
|
@cindex PANIC program
|
|
@cindex networks @seealso{web pages}
|
|
@cindex web service
|
|
At first glance, the @code{"Hello, world"} example in
|
|
@ref{Primitive Service, ,A Primitive Web Service},
|
|
seems useless. By adding just a few lines, we can turn it into something useful.
|
|
|
|
The PANIC program tells everyone who connects that the local
|
|
site is not working. When a web server breaks down, it makes a difference
|
|
if customers get a strange ``network unreachable'' message, or a short message
|
|
telling them that the server has a problem. In such an emergency,
|
|
the hard disk and everything on it (including the regular web service) may
|
|
be unavailable. Rebooting the web server off a USB drive makes sense in this
|
|
setting.
|
|
|
|
To use the PANIC program as an emergency web server, all you need are the
|
|
@command{gawk} executable and the program below on a USB drive. By default,
|
|
it connects to port 8080. A different value may be supplied on the
|
|
command line:
|
|
|
|
@example
|
|
@c file eg/network/panic.awk
|
|
BEGIN @{
|
|
RS = ORS = "\r\n"
|
|
if (MyPort == 0) MyPort = 8080
|
|
HttpService = "/inet/tcp/" MyPort "/0/0"
|
|
Hello = "<HTML><HEAD><TITLE>Out Of Service</TITLE>" \
|
|
"</HEAD><BODY><H1>" \
|
|
"This site is temporarily out of service." \
|
|
"</H1></BODY></HTML>"
|
|
Len = length(Hello) + length(ORS)
|
|
while ("awk" != "complex") @{
|
|
print "HTTP/1.0 200 OK" |& HttpService
|
|
print "Content-Length: " Len ORS |& HttpService
|
|
print Hello |& HttpService
|
|
while ((HttpService |& getline) > 0)
|
|
continue;
|
|
close(HttpService)
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@node GETURL, REMCONF, PANIC, Some Applications and Techniques
|
|
@section GETURL: Retrieving Web Pages
|
|
@cindex GETURL program
|
|
@cindex web pages @subentry retrieving
|
|
GETURL is a versatile building block for shell scripts that need to retrieve
|
|
files from the Internet. It takes a web address as a command-line parameter and
|
|
tries to retrieve the contents of this address. The contents are printed
|
|
to standard output, while the header is printed to @file{/dev/stderr}.
|
|
A surrounding shell script
|
|
could analyze the contents and extract the text or the links. An ASCII
|
|
browser could be written around GETURL. But more interestingly, web robots are
|
|
straightforward to write on top of GETURL. On the Internet, you can find
|
|
several programs of the same name that do the same job. They are usually
|
|
much more complex internally and at least 10 times as big.
|
|
|
|
At first, GETURL checks if it was called with exactly one web address.
|
|
Then, it checks if the user chose to use a special proxy server whose name
|
|
is handed over in a variable. By default, it is assumed that the local
|
|
machine serves as proxy. GETURL uses the @code{GET} method by default
|
|
to access the web page. By handing over the name of a different method
|
|
(such as @code{HEAD}), it is possible to choose a different behavior. With
|
|
the @code{HEAD} method, the user does not receive the body of the page
|
|
content, but does receive the header:
|
|
|
|
@example
|
|
@c file eg/network/geturl.awk
|
|
BEGIN @{
|
|
if (ARGC != 2) @{
|
|
print "GETURL - retrieve Web page via HTTP 1.0"
|
|
print "IN:\n the URL as a command-line parameter"
|
|
print "PARAM(S):\n -v Proxy=MyProxy"
|
|
print "OUT:\n the page content on stdout"
|
|
print " the page header on stderr"
|
|
print "JK 16.05.1997"
|
|
print "ADR 13.08.2000"
|
|
exit
|
|
@}
|
|
URL = ARGV[1]; ARGV[1] = ""
|
|
if (Proxy == "") Proxy = "127.0.0.1"
|
|
if (ProxyPort == 0) ProxyPort = 80
|
|
if (Method == "") Method = "GET"
|
|
HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
|
|
ORS = RS = "\r\n\r\n"
|
|
print Method " " URL " HTTP/1.0" |& HttpService
|
|
HttpService |& getline Header
|
|
print Header > "/dev/stderr"
|
|
while ((HttpService |& getline) > 0)
|
|
printf "%s", $0
|
|
close(HttpService)
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
This program can be changed as needed, but be careful with the last lines.
|
|
Make sure transmission of binary data is not corrupted by additional line
|
|
breaks. Even as it is now, the byte sequence @code{"\r\n\r\n"} would
|
|
disappear if it were contained in binary data. Don't get caught in a
|
|
trap when trying a quick fix on this one.
|
|
|
|
@node REMCONF, URLCHK, GETURL, Some Applications and Techniques
|
|
@section REMCONF: Remote Configuration of Embedded Systems
|
|
@cindex REMCONF program
|
|
@cindex Linux
|
|
@cindex GNU/Linux
|
|
@cindex Yahoo!
|
|
Today, you often find powerful processors in embedded systems. Dedicated
|
|
network routers and controllers for all kinds of machinery are examples
|
|
of embedded systems. Processors like the Intel 80x86 or the AMD Elan are
|
|
able to run multitasking operating systems, such as XINU or GNU/Linux
|
|
in embedded PCs. These systems are small and usually do not have
|
|
a keyboard or a display. Therefore it is difficult to set up their
|
|
configuration. There are several widespread ways to set them up:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
DIP switches
|
|
|
|
@item
|
|
Read Only Memories such as EPROMs
|
|
|
|
@item
|
|
Serial lines or some kind of keyboard
|
|
|
|
@item
|
|
Network connections via @command{telnet} or SNMP
|
|
|
|
@item
|
|
HTTP connections with HTML GUIs
|
|
@end itemize
|
|
|
|
In this @value{SECTION}, we look at a solution that uses HTTP connections
|
|
to control variables of an embedded system that are stored in a file.
|
|
Since embedded systems have tight limits on resources like memory,
|
|
it is difficult to employ advanced techniques such as SNMP and HTTP
|
|
servers. @command{gawk} fits in quite nicely with its single executable
|
|
which needs just a short script to start working.
|
|
The following program stores the variables in a file, and a concurrent
|
|
process in the embedded system may read the file. The program uses the
|
|
site-independent part of the simple web server that we developed in
|
|
@ref{Interacting Service, ,A Web Service with Interaction}.
|
|
As mentioned there, all we have to do is to write two new procedures
|
|
@code{SetUpServer()} and @code{HandleGET()}:
|
|
|
|
@smallexample
|
|
@c file eg/network/remconf.awk
|
|
function SetUpServer() @{
|
|
TopHeader = "<HTML><title>Remote Configuration</title>"
|
|
TopDoc = "<BODY>\
|
|
<h2>Please choose one of the following actions:</h2>\
|
|
<UL>\
|
|
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
|
|
<LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A></LI>\
|
|
<LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A></LI>\
|
|
<LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A></LI>\
|
|
<LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A></LI>\
|
|
</UL>"
|
|
TopFooter = "</BODY></HTML>"
|
|
if (ConfigFile == "") ConfigFile = "config.asc"
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The function @code{SetUpServer()} initializes the top level HTML texts
|
|
as usual. It also initializes the name of the file that contains the
|
|
configuration parameters and their values. In case the user supplies
|
|
a name from the command line, that name is used. The file is expected to
|
|
contain one parameter per line, with the name of the parameter in
|
|
column one and the value in column two.
|
|
|
|
The function @code{HandleGET()} reflects the structure of the menu
|
|
tree as usual. The first menu choice tells the user what this is all
|
|
about. The second choice reads the configuration file line by line
|
|
and stores the parameters and their values. Notice that the record
|
|
separator for this file is @code{"\n"}, in contrast to the record separator
|
|
for HTTP. The third menu choice builds an HTML table to show
|
|
the contents of the configuration file just read. The fourth choice
|
|
does the real work of changing parameters, and the last one just saves
|
|
the configuration into a file:
|
|
|
|
@smallexample
|
|
@c file eg/network/remconf.awk
|
|
function HandleGET() @{
|
|
if (MENU[2] == "AboutServer") @{
|
|
Document = "This is a GUI for remote configuration of an\
|
|
embedded system. It is is implemented as one GAWK script."
|
|
@} else if (MENU[2] == "ReadConfig") @{
|
|
RS = "\n"
|
|
while ((getline < ConfigFile) > 0)
|
|
config[$1] = $2;
|
|
close(ConfigFile)
|
|
RS = "\r\n"
|
|
Document = "Configuration has been read."
|
|
@} else if (MENU[2] == "CheckConfig") @{
|
|
Document = "<TABLE BORDER=1 CELLPADDING=5>"
|
|
for (i in config)
|
|
Document = Document "<TR><TD>" i "</TD>" \
|
|
"<TD>" config[i] "</TD></TR>"
|
|
Document = Document "</TABLE>"
|
|
@} else if (MENU[2] == "ChangeConfig") @{
|
|
if ("Param" in GETARG) @{ # any parameter to set?
|
|
if (GETARG["Param"] in config) @{ # is parameter valid?
|
|
config[GETARG["Param"]] = GETARG["Value"]
|
|
Document = (GETARG["Param"] " = " GETARG["Value"] ".")
|
|
@} else @{
|
|
Document = "Parameter <b>" GETARG["Param"] "</b> is invalid."
|
|
@}
|
|
@} else @{
|
|
Document = "<FORM method=GET><h4>Change one parameter</h4>\
|
|
<TABLE BORDER CELLPADDING=5>\
|
|
<TR><TD>Parameter</TD><TD>Value</TD></TR>\
|
|
<TR><TD><input type=text name=Param value=\"\" size=20></TD>\
|
|
<TD><input type=text name=Value value=\"\" size=40></TD>\
|
|
</TR></TABLE><input type=submit value=\"Set\"></FORM>"
|
|
@}
|
|
@} else if (MENU[2] == "SaveConfig") @{
|
|
for (i in config)
|
|
printf("%s %s\n", i, config[i]) > ConfigFile
|
|
close(ConfigFile)
|
|
Document = "Configuration has been saved."
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
@cindex MiniSQL
|
|
We could also view the configuration file as a database. From this
|
|
point of view, the previous program acts like a primitive database server.
|
|
Real SQL database systems also make a service available by providing
|
|
a TCP port that clients can connect to. But the application level protocols
|
|
they use are usually proprietary and also change from time to time.
|
|
This is also true for the protocol that
|
|
MiniSQL uses.
|
|
|
|
@node URLCHK, WEBGRAB, REMCONF, Some Applications and Techniques
|
|
@section URLCHK: Look for Changed Web Pages
|
|
@cindex URLCHK program
|
|
Most people who make heavy use of Internet resources have a large
|
|
bookmark file with pointers to interesting web sites. It is impossible
|
|
to regularly check by hand if any of these sites have changed. A program
|
|
is needed to automatically look at the headers of web pages and tell
|
|
which ones have changed. URLCHK does the comparison after using GETURL
|
|
with the @code{HEAD} method to retrieve the header.
|
|
|
|
Like GETURL, this program first checks that it is called with exactly
|
|
one command-line parameter. URLCHK also takes the same command-line variables
|
|
@code{Proxy} and @code{ProxyPort} as GETURL,
|
|
because these variables are handed over to GETURL for each URL
|
|
that gets checked. The one and only parameter is the name of a file that
|
|
contains one line for each URL. In the first column, we find the URL, and
|
|
the second and third columns hold the length of the URL's body when checked
|
|
for the two last times. Now, we follow this plan:
|
|
|
|
@enumerate
|
|
@item
|
|
Read the URLs from the file and remember their most recent lengths
|
|
|
|
@item
|
|
Delete the contents of the file
|
|
|
|
@item
|
|
For each URL, check its new length and write it into the file
|
|
|
|
@item
|
|
If the most recent and the new length differ, tell the user
|
|
@end enumerate
|
|
|
|
It may seem a bit peculiar to read the URLs from a file together
|
|
with their two most recent lengths, but this approach has several
|
|
advantages. You can call the program again and again with the same
|
|
file. After running the program, you can regenerate the changed URLs
|
|
by extracting those lines that differ in their second and third columns:
|
|
|
|
@c inspired by URLCHK in iX 5/97 166.
|
|
@smallexample
|
|
@c file eg/network/urlchk.awk
|
|
BEGIN @{
|
|
if (ARGC != 2) @{
|
|
print "URLCHK - check if URLs have changed"
|
|
print "IN:\n the file with URLs as a command-line parameter"
|
|
print " file contains URL, old length, new length"
|
|
print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
|
|
print "OUT:\n same as file with URLs"
|
|
print "JK 02.03.1998"
|
|
exit
|
|
@}
|
|
URLfile = ARGV[1]; ARGV[1] = ""
|
|
if (Proxy != "") Proxy = " -v Proxy=" Proxy
|
|
if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
|
|
while ((getline < URLfile) > 0)
|
|
Length[$1] = $3 + 0
|
|
close(URLfile) # now, URLfile is read in and can be updated
|
|
GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
|
|
for (i in Length) @{
|
|
GetThisHeader = GetHeader i " 2>&1"
|
|
while ((GetThisHeader | getline) > 0)
|
|
if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
|
|
close(GetThisHeader)
|
|
print i, Length[i], NewLength > URLfile
|
|
if (Length[i] != NewLength) # report only changed URLs
|
|
print i, Length[i], NewLength
|
|
@}
|
|
close(URLfile)
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Another thing that may look strange is the way GETURL is called.
|
|
Before calling GETURL, we have to check if the proxy variables need
|
|
to be passed on. If so, we prepare strings that will become part
|
|
of the command line later. In @code{GetHeader}, we store these strings
|
|
together with the longest part of the command line. Later, in the loop
|
|
over the URLs, @code{GetHeader} is appended with the URL and a redirection
|
|
operator to form the command that reads the URL's header over the Internet.
|
|
GETURL always sends the headers to @file{/dev/stderr}. That is
|
|
the reason why we need the redirection operator to have the header
|
|
piped in.
|
|
|
|
This program is not perfect because it assumes that changing URLs
|
|
results in changed lengths, which is not necessarily true. A more
|
|
advanced approach is to look at some other header line that
|
|
holds time information. But, as always when things get a bit more
|
|
complicated, this is left as an exercise to the reader.
|
|
|
|
@node WEBGRAB, STATIST, URLCHK, Some Applications and Techniques
|
|
@section WEBGRAB: Extract Links from a Page
|
|
@cindex WEBGRAB program
|
|
@c Inspired by iX 1/98 157.
|
|
@cindex robot
|
|
Sometimes it is necessary to extract links from web pages.
|
|
Browsers do it, web robots do it, and sometimes even humans do it.
|
|
Since we have a tool like GETURL at hand, we can solve this problem with
|
|
some help from the Bourne shell:
|
|
|
|
@example
|
|
@c file eg/network/webgrab.awk
|
|
BEGIN @{ RS = "https?://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" @}
|
|
RT != "" @{
|
|
command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
|
|
" > doc" NR ".html")
|
|
print command
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
Notice that the regular expression for URLs is rather crude. A precise
|
|
regular expression is much more complex. But this one works
|
|
rather well. One problem is that it is unable to find internal links of
|
|
an HTML document. Another problem is that
|
|
@samp{ftp}, @samp{telnet}, @samp{news}, @samp{mailto}, and other kinds
|
|
of links are missing in the regular expression.
|
|
However, it is straightforward to add them, if doing so is necessary for other tasks.
|
|
|
|
This program reads an HTML file and prints all the HTTP links that it finds.
|
|
It relies on @command{gawk}'s ability to use regular expressions as the record
|
|
separator. With @code{RS} set to a regular expression that matches links,
|
|
the second action is executed each time a non-empty link is found.
|
|
We can find the matching link itself in @code{RT}.
|
|
|
|
The action could use the @code{system()} function to let another GETURL
|
|
retrieve the page, but here we use a different approach.
|
|
This simple program prints shell commands that can be piped into @command{sh}
|
|
for execution. This way it is possible to first extract
|
|
the links, wrap shell commands around them, and pipe all the shell commands
|
|
into a file. After editing the file, execution of the file retrieves
|
|
only those files that we really need. In case we do not want to edit,
|
|
we can retrieve all the pages like this:
|
|
|
|
@smallexample
|
|
gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
|
|
@end smallexample
|
|
|
|
@cindex Microsoft Windows
|
|
After this, you will find the contents of all referenced documents in
|
|
files named @file{doc*.html} even if they do not contain HTML code.
|
|
The most annoying thing is that we always have to pass the proxy to
|
|
GETURL. If you do not like to see the headers of the web pages
|
|
appear on the screen, you can redirect them to @file{/dev/null}.
|
|
Watching the headers appear can be quite interesting, because
|
|
it reveals
|
|
interesting details such as which web server the companies use.
|
|
Now, it is clear how the clever marketing people
|
|
use web robots to determine the
|
|
market shares
|
|
of Microsoft and Netscape in the web server market.
|
|
|
|
Port 80 of any web server is like a small hole in a repellent firewall.
|
|
After attaching a browser to port 80, we usually catch a glimpse
|
|
of the bright side of the server (its home page). With a tool like GETURL
|
|
at hand, we are able to discover some of the more concealed
|
|
or even ``indecent'' services (i.e., lacking conformity to standards of quality).
|
|
It can be exciting to see the fancy CGI scripts that lie
|
|
there, revealing the inner workings of the server, ready to be called:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
With a command such as:
|
|
|
|
@example
|
|
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
|
|
@end example
|
|
|
|
some servers give you a directory listing of the CGI files.
|
|
Knowing the names, you can try to call some of them and watch
|
|
for useful results. Sometimes there are executables in such directories
|
|
(such as Perl interpreters) that you may call remotely. If there are
|
|
subdirectories with configuration data of the web server, this can also
|
|
be quite interesting to read.
|
|
|
|
@item
|
|
@cindex apache
|
|
The well-known Apache web server usually has its CGI files in the
|
|
directory @file{/cgi-bin}. There you can often find the scripts
|
|
@file{test-cgi} and @file{printenv}. Both tell you some things
|
|
about the current connection and the installation of the web server.
|
|
Just call:
|
|
|
|
@smallexample
|
|
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
|
|
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
|
|
@end smallexample
|
|
|
|
@item
|
|
Sometimes it is even possible to retrieve system files like the web
|
|
server's log file---possibly containing customer data---or even the file
|
|
@file{/etc/passwd}.
|
|
(We don't recommend this!)
|
|
@end itemize
|
|
|
|
@strong{Caution:}
|
|
Although this may sound funny or simply irrelevant, we are talking about
|
|
severe security holes. Try to explore your own system this way and make
|
|
sure that none of the above reveals too much information about your system.
|
|
|
|
@node STATIST, MAZE, WEBGRAB, Some Applications and Techniques
|
|
@section STATIST: Graphing a Statistical Distribution
|
|
@cindex STATIST program
|
|
|
|
@cindex GNUPlot utility
|
|
@cindex image format
|
|
@cindex GIF image format
|
|
@cindex PNG image format
|
|
@cindex PS image format
|
|
@cindex Boutell, Thomas
|
|
@image{statist,3in}
|
|
|
|
In the HTTP server examples we've shown thus far, we never present an image
|
|
to the browser and its user. Presenting images is one task. Generating
|
|
images that reflect some user input and presenting these dynamically
|
|
generated images is another. In this @value{SECTION}, we use GNUPlot
|
|
for generating @file{.png}, @file{.ps}, or @file{.gif}
|
|
files.@footnote{Due to licensing problems, the default
|
|
installation of GNUPlot disables the generation of @file{.gif} files.
|
|
If your installed version does not accept @samp{set term gif},
|
|
just download and install the most recent version of GNUPlot and the
|
|
@uref{https://libgd.github.io/, GD library}
|
|
by Thomas Boutell.
|
|
Otherwise you still have the chance to generate some
|
|
ASCII-art style images with GNUPlot by using @samp{set term dumb}.
|
|
(We tried it and it worked.)}
|
|
|
|
@cindex Numerical Recipes
|
|
The program we develop takes the statistical parameters of two samples
|
|
and computes the t-test statistics. As a result, we get the probabilities
|
|
that the means and the variances of both samples are the same. In order to
|
|
let the user check plausibility, the program presents an image of the
|
|
distributions. The statistical computation follows
|
|
@cite{Numerical Recipes in C: The Art of Scientific Computing}
|
|
by William H.@: Press, Saul A.@: Teukolsky, William T.@: Vetterling, and Brian P. Flannery.
|
|
Since @command{gawk} does not have a built-in function
|
|
for the computation of the beta function, we use the @code{ibeta()} function
|
|
of GNUPlot. As a side effect, we learn how to use GNUPlot as a
|
|
sophisticated calculator. The comparison of means is done as in @code{tutest},
|
|
paragraph 14.2, page 613, and the comparison of variances is done as in @code{ftest},
|
|
page 611 in @cite{Numerical Recipes}.
|
|
|
|
As usual, we take the site-independent code for servers and append
|
|
our own functions @code{SetUpServer()} and @code{HandleGET()}:
|
|
|
|
@smallexample
|
|
@c file eg/network/statist.awk
|
|
function SetUpServer() @{
|
|
TopHeader = "<HTML><title>Statistics with GAWK</title>"
|
|
TopDoc = "<BODY>\
|
|
<h2>Please choose one of the following actions:</h2>\
|
|
<UL>\
|
|
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A></LI>\
|
|
<LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A></LI>\
|
|
</UL>"
|
|
TopFooter = "</BODY></HTML>"
|
|
GnuPlot = "gnuplot 2>&1"
|
|
m1=m2=0; v1=v2=1; n1=n2=10
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Here, you see the menu structure that the user sees. Later, we
|
|
will see how the program structure of the @code{HandleGET()} function
|
|
reflects the menu structure. What is missing here is the link for the
|
|
image we generate. In an event-driven environment, request,
|
|
generation, and delivery of images are separated.
|
|
|
|
Notice the way we initialize the @code{GnuPlot} command string for
|
|
the pipe. By default,
|
|
GNUPlot outputs the generated image via standard output, as well as
|
|
the results of @code{print}(ed) calculations via standard error.
|
|
The redirection causes standard error to be mixed into standard
|
|
output, enabling us to read results of calculations with @code{getline}.
|
|
By initializing the statistical parameters with some meaningful
|
|
defaults, we make sure the user gets an image the first time
|
|
he uses the program.
|
|
|
|
@cindex JavaScript
|
|
Following is the rather long function @code{HandleGET()}, which
|
|
implements the contents of this service by reacting to the different
|
|
kinds of requests from the browser. Before you start playing with
|
|
this script, make sure that your browser supports JavaScript and that it also
|
|
has this option switched on. The script uses a short snippet of
|
|
JavaScript code for delayed opening of a window with an image.
|
|
A more detailed explanation follows:
|
|
|
|
@smallexample
|
|
@c file eg/network/statist.awk
|
|
function HandleGET() @{
|
|
if (MENU[2] == "AboutServer") @{
|
|
Document = "This is a GUI for a statistical computation.\
|
|
It compares means and variances of two distributions.\
|
|
It is implemented as one GAWK script and uses GNUPLOT."
|
|
@} else if (MENU[2] == "EnterParameters") @{
|
|
Document = ""
|
|
if ("m1" in GETARG) @{ # are there parameters to compare?
|
|
Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\
|
|
setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\
|
|
"\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>"
|
|
m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
|
|
m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
|
|
t = (m1-m2)/sqrt(v1/n1+v2/n2)
|
|
df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
|
|
+ (v2/n2)*(v2/n2) /(n2-1))
|
|
if (v1>v2) @{
|
|
f = v1/v2
|
|
df1 = n1 - 1
|
|
df2 = n2 - 1
|
|
@} else @{
|
|
f = v2/v1
|
|
df1 = n2 - 1
|
|
df2 = n1 - 1
|
|
@}
|
|
print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
|
|
print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
|
|
df2/(df2+df1*f) ")" |& GnuPlot
|
|
print "print pt, pF" |& GnuPlot
|
|
RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
|
|
print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
|
|
print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
|
|
print "set term png small color" |& GnuPlot
|
|
#print "set term postscript color" |& GnuPlot
|
|
#print "set term gif medium size 320,240" |& GnuPlot
|
|
print "set yrange[-0.3:]" |& GnuPlot
|
|
print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
|
|
print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
|
|
print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
|
|
mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
|
|
print "quit" |& GnuPlot
|
|
GnuPlot |& getline Image
|
|
while ((GnuPlot |& getline) > 0)
|
|
Image = Image RS $0
|
|
close(GnuPlot)
|
|
@}
|
|
Document = Document "\
|
|
<h3>Do these samples have the same Gaussian distribution?</h3>\
|
|
<FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\
|
|
<TR>\
|
|
<TD>1. Mean </TD>
|
|
<TD><input type=text name=m1 value=" m1 " size=8></TD>\
|
|
<TD>1. Variance</TD>
|
|
<TD><input type=text name=v1 value=" v1 " size=8></TD>\
|
|
<TD>1. Count </TD>
|
|
<TD><input type=text name=n1 value=" n1 " size=8></TD>\
|
|
</TR><TR>\
|
|
<TD>2. Mean </TD>
|
|
<TD><input type=text name=m2 value=" m2 " size=8></TD>\
|
|
<TD>2. Variance</TD>
|
|
<TD><input type=text name=v2 value=" v2 " size=8></TD>\
|
|
<TD>2. Count </TD>
|
|
<TD><input type=text name=n2 value=" n2 " size=8></TD>\
|
|
</TR> <input type=submit value=\"Compute\">\
|
|
</TABLE></FORM><BR>"
|
|
@} else if (MENU[2] ~ "Image") @{
|
|
Reason = "OK" ORS "Content-type: image/png"
|
|
#Reason = "OK" ORS "Content-type: application/x-postscript"
|
|
#Reason = "OK" ORS "Content-type: image/gif"
|
|
Header = Footer = ""
|
|
Document = Image
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
@cindex PostScript
|
|
As usual, we give a short description of the service in the first
|
|
menu choice. The third menu choice shows us that generation and
|
|
presentation of an image are two separate actions. While the latter
|
|
takes place quite instantly in the third menu choice, the former
|
|
takes place in the much longer second choice. Image data passes from the
|
|
generating action to the presenting action via the variable @code{Image}
|
|
that contains a complete @file{.png} image, which is otherwise stored
|
|
in a file. If you prefer @file{.ps} or @file{.gif} images over the
|
|
default @file{.png} images, you may select these options by uncommenting
|
|
the appropriate lines. But remember to do so in two places: when
|
|
telling GNUPlot which kind of images to generate, and when transmitting the
|
|
image at the end of the program.
|
|
|
|
Looking at the end of the program,
|
|
the way we pass the @samp{Content-type} to the browser is a bit unusual.
|
|
It is appended to the @samp{OK} of the first header line
|
|
to make sure the type information becomes part of the header.
|
|
The other variables that get transmitted across the network are
|
|
made empty, because in this case we do not have an HTML document to
|
|
transmit, but rather raw image data to contain in the body.
|
|
|
|
Most of the work is done in the second menu choice. It starts with a
|
|
strange JavaScript code snippet. When first implementing this server,
|
|
we used a short @samp{@w{"<IMG SRC="} MyPrefix "/Image>"} here. But then
|
|
browsers got smarter and tried to improve on speed by requesting the
|
|
image and the HTML code at the same time. When doing this, the browser
|
|
tries to build up a connection for the image request while the request for
|
|
the HTML text is not yet completed. The browser tries to connect
|
|
to the @command{gawk} server on port 8080 while port 8080 is still in use for
|
|
transmission of the HTML text. The connection for the image cannot be
|
|
built up, so the image appears as ``broken'' in the browser window.
|
|
We solved this problem by telling the browser to open a separate window
|
|
for the image, but only after a delay of 1000 milliseconds.
|
|
By this time, the server should be ready for serving the next request.
|
|
|
|
But there is one more subtlety in the JavaScript code.
|
|
Each time the JavaScript code opens a window for the image, the
|
|
name of the image is appended with a timestamp (@code{systime()}).
|
|
Why this constant change of name for the image? Initially, we always named
|
|
the image @code{Image}, but then the Netscape browser noticed the name
|
|
had @emph{not} changed since the previous request and displayed the
|
|
previous image (caching behavior). The server core
|
|
is implemented so that browsers are told @emph{not} to cache anything.
|
|
Obviously HTTP requests do not always work as expected. One way to
|
|
circumvent the cache of such overly smart browsers is to change the
|
|
name of the image with each request. These three lines of JavaScript
|
|
caused us a lot of trouble.
|
|
|
|
The rest can be broken
|
|
down into two phases. At first, we check if there are statistical
|
|
parameters. When the program is first started, there usually are no
|
|
parameters because it enters the page coming from the top menu.
|
|
Then, we only have to present the user a form that he can use to change
|
|
statistical parameters and submit them. Subsequently, the submission of
|
|
the form causes the execution of the first phase because @emph{now}
|
|
there @emph{are} parameters to handle.
|
|
|
|
Now that we have parameters, we know there will be an image available.
|
|
Therefore we insert the JavaScript code here to initiate the opening
|
|
of the image in a separate window. Then,
|
|
we prepare some variables that will be passed to GNUPlot for calculation
|
|
of the probabilities. Prior to reading the results, we must temporarily
|
|
change @code{RS} because GNUPlot separates lines with newlines.
|
|
After instructing GNUPlot to generate a @file{.png} (or @file{.ps} or
|
|
@file{.gif}) image, we initiate the insertion of some text,
|
|
explaining the resulting probabilities. The final @samp{plot} command
|
|
actually generates the image data. This raw binary has to be read in carefully
|
|
without adding, changing, or deleting a single byte. Hence the unusual
|
|
initialization of @code{Image} and completion with a @code{while} loop.
|
|
|
|
When using this server, it soon becomes clear that it is far from being
|
|
perfect. It mixes source code of six scripting languages or protocols:
|
|
|
|
@itemize @bullet
|
|
@item GNU @command{awk} implements a server for the protocol:
|
|
@item HTTP which transmits:
|
|
@item HTML text which contains a short piece of:
|
|
@item JavaScript code opening a separate window.
|
|
@item A Bourne shell script is used for piping commands into:
|
|
@item GNUPlot to generate the image to be opened.
|
|
@end itemize
|
|
|
|
After all this work, the GNUPlot image opens in the JavaScript window
|
|
where it can be viewed by the user.
|
|
|
|
It is probably better not to mix up so many different languages.
|
|
The result is not very readable. Furthermore, the
|
|
statistical part of the server does not take care of invalid input.
|
|
Among others, using negative variances causes invalid results.
|
|
|
|
@node MAZE, MOBAGWHO, STATIST, Some Applications and Techniques
|
|
@section MAZE: Walking Through a Maze In Virtual Reality
|
|
@cindex MAZE
|
|
@cindex VRML
|
|
@c VRML in iX 11/96 134.
|
|
@quotation
|
|
@cindex Perlis, Alan
|
|
@i{In the long run, every program becomes rococo, and then rubble.}@*
|
|
@author Alan Perlis
|
|
@end quotation
|
|
|
|
By now, we know how to present arbitrary @samp{Content-type}s to a browser.
|
|
In this @value{SECTION}, our server presents a 3D world to our browser.
|
|
The 3D world is described in a scene description language (VRML,
|
|
Virtual Reality Modeling Language) that allows us to travel through a
|
|
perspective view of a 2D maze with our browser. Browsers with a
|
|
VRML plugin enable exploration of this technology. We could do
|
|
one of those boring @samp{Hello world} examples here, that are usually
|
|
presented when introducing novices to
|
|
VRML. If you have never written
|
|
any VRML code, have a look at
|
|
the VRML FAQ.
|
|
Presenting a static VRML scene is a bit trivial; in order to expose
|
|
@command{gawk}'s capabilities, we will present a dynamically generated
|
|
VRML scene. The function @code{SetUpServer()} is very simple because it
|
|
only sets the default HTML page and initializes the random number
|
|
generator. As usual, the surrounding server lets you browse the maze.
|
|
|
|
@smallexample
|
|
@c file eg/network/maze.awk
|
|
function SetUpServer() @{
|
|
TopHeader = "<HTML><title>Walk through a maze</title>"
|
|
TopDoc = "\
|
|
<h2>Please choose one of the following actions:</h2>\
|
|
<UL>\
|
|
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
|
|
<LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\
|
|
</UL>"
|
|
TopFooter = "</HTML>"
|
|
srand()
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The function @code{HandleGET()} is a bit longer because it first computes
|
|
the maze and afterwards generates the VRML code that is sent across
|
|
the network. As shown in the STATIST example
|
|
(@pxref{STATIST}),
|
|
we set the type of the
|
|
content to VRML and then store the VRML representation of the maze as the
|
|
page content. We assume that the maze is stored in a 2D array. Initially,
|
|
the maze consists of walls only. Then, we add an entry and an exit to the
|
|
maze and let the rest of the work be done by the function @code{MakeMaze()}.
|
|
Now, only the wall fields are left in the maze. By iterating over the these
|
|
fields, we generate one line of VRML code for each wall field.
|
|
|
|
@smallexample
|
|
@c file eg/network/maze.awk
|
|
function HandleGET() @{
|
|
if (MENU[2] == "AboutServer") @{
|
|
Document = "If your browser has a VRML 2 plugin,\
|
|
this server shows you a simple VRML scene."
|
|
@} else if (MENU[2] == "VRMLtest") @{
|
|
XSIZE = YSIZE = 11 # initially, everything is wall
|
|
for (y = 0; y < YSIZE; y++)
|
|
for (x = 0; x < XSIZE; x++)
|
|
Maze[x, y] = "#"
|
|
delete Maze[0, 1] # entry is not wall
|
|
delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
|
|
MakeMaze(1, 1)
|
|
Document = "\
|
|
#VRML V2.0 utf8\n\
|
|
Group @{\n\
|
|
children [\n\
|
|
PointLight @{\n\
|
|
ambientIntensity 0.2\n\
|
|
color 0.7 0.7 0.7\n\
|
|
location 0.0 8.0 10.0\n\
|
|
@}\n\
|
|
DEF B1 Background @{\n\
|
|
skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
|
|
skyAngle 1.6\n\
|
|
groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
|
|
groundAngle [ 1.2 1.57 ]\n\
|
|
@}\n\
|
|
DEF Wall Shape @{\n\
|
|
geometry Box @{size 1 1 1@}\n\
|
|
appearance Appearance @{ material Material @{ diffuseColor 0 0 1 @} @}\n\
|
|
@}\n\
|
|
DEF Entry Viewpoint @{\n\
|
|
position 0.5 1.0 5.0\n\
|
|
orientation 0.0 0.0 -1.0 0.52\n\
|
|
@}\n"
|
|
for (i in Maze) @{
|
|
split(i, t, SUBSEP)
|
|
Document = Document " Transform @{ translation "
|
|
Document = Document t[1] " 0 -" t[2] " children USE Wall @}\n"
|
|
@}
|
|
Document = Document " ] # end of group for world\n@}"
|
|
Reason = "OK" ORS "Content-type: model/vrml"
|
|
Header = Footer = ""
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Finally, we have a look at @code{MakeMaze()}, the function that generates
|
|
the @code{Maze} array. When entered, this function assumes that the array
|
|
has been initialized so that each element represents a wall element and
|
|
the maze is initially full of wall elements. Only the entrance and the exit
|
|
of the maze should have been left free. The parameters of the function tell
|
|
us which element must be marked as not being a wall. After this, we take
|
|
a look at the four neighboring elements and remember which we have already
|
|
treated. Of all the neighboring elements, we take one at random and
|
|
walk in that direction. Therefore, the wall element in that direction has
|
|
to be removed and then, we call the function recursively for that element.
|
|
The maze is only completed if we iterate the above procedure for
|
|
@emph{all} neighboring elements (in random order) and for our present
|
|
element by recursively calling the function for the present element. This
|
|
last iteration could have been done in a loop,
|
|
but it is done much simpler recursively.
|
|
|
|
Notice that elements with coordinates that are both odd are assumed to be
|
|
on our way through the maze and the generating process cannot terminate
|
|
as long as there is such an element not being @code{delete}d. All other
|
|
elements are potentially part of the wall.
|
|
|
|
@smallexample
|
|
@c file eg/network/maze.awk
|
|
function MakeMaze(x, y) @{
|
|
delete Maze[x, y] # here we are, we have no wall here
|
|
p = 0 # count unvisited fields in all directions
|
|
if (x-2 SUBSEP y in Maze) d[p++] = "-x"
|
|
if (x SUBSEP y-2 in Maze) d[p++] = "-y"
|
|
if (x+2 SUBSEP y in Maze) d[p++] = "+x"
|
|
if (x SUBSEP y+2 in Maze) d[p++] = "+y"
|
|
if (p>0) @{ # if there are unvisited fields, go there
|
|
p = int(p*rand()) # choose one unvisited field at random
|
|
if (d[p] == "-x") @{ delete Maze[x - 1, y]; MakeMaze(x - 2, y)
|
|
@} else if (d[p] == "-y") @{ delete Maze[x, y - 1]; MakeMaze(x, y - 2)
|
|
@} else if (d[p] == "+x") @{ delete Maze[x + 1, y]; MakeMaze(x + 2, y)
|
|
@} else if (d[p] == "+y") @{ delete Maze[x, y + 1]; MakeMaze(x, y + 2)
|
|
@} # we are back from recursion
|
|
MakeMaze(x, y); # try again while there are unvisited fields
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
@node MOBAGWHO, STOXPRED, MAZE, Some Applications and Techniques
|
|
@section MOBAGWHO: a Simple Mobile Agent
|
|
@cindex MOBAGWHO program
|
|
@cindex agent
|
|
@quotation
|
|
@cindex Hoare, C.A.R.
|
|
@i{There are two ways of constructing a software design: One way is to
|
|
make it so simple that there are obviously no deficiencies, and the
|
|
other way is to make it so complicated that there are no obvious
|
|
deficiencies.}
|
|
@author C.A.R.@: Hoare
|
|
@end quotation
|
|
|
|
A @dfn{mobile agent} is a program that can be dispatched from a computer and
|
|
transported to a remote server for execution. This is called @dfn{migration},
|
|
which means that a process on another system is started that is independent
|
|
from its originator. Ideally, it wanders through
|
|
a network while working for its creator or owner. In places like
|
|
the UMBC Agent Web,
|
|
people are quite confident that (mobile) agents are a software engineering
|
|
paradigm that enables us to significantly increase the efficiency
|
|
of our work. Mobile agents could become the mediators between users and
|
|
the networking world. For an unbiased view at this technology,
|
|
see the remarkable paper @cite{Mobile Agents: Are they a good
|
|
idea?}.@footnote{@uref{https://link.springer.com/chapter/10.1007/3-540-62852-5_4}}
|
|
|
|
When trying to migrate a process from one system to another,
|
|
a server process is needed on the receiving side. Depending on the kind
|
|
of server process, several ways of implementation come to mind.
|
|
How the process is implemented depends upon the kind of server process:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
HTTP can be used as the protocol for delivery of the migrating
|
|
process. In this case, we use a common web
|
|
server as the receiving server process. A universal CGI script
|
|
mediates between migrating process and web server.
|
|
Each server willing to accept migrating agents makes this universal
|
|
service available. HTTP supplies the @code{POST} method to transfer
|
|
some data to a file on the web server. When a CGI script is called
|
|
remotely with the @code{POST} method instead of the usual @code{GET} method,
|
|
data is transmitted from the client process to the standard input
|
|
of the server's CGI script. So, to implement a mobile agent,
|
|
we must not only write the agent program to start on the client
|
|
side, but also the CGI script to receive the agent on the server side.
|
|
|
|
@cindex CGI (Common Gateway Interface)
|
|
@cindex apache
|
|
@item
|
|
The @code{PUT} method can also be used for migration. HTTP does not
|
|
require a CGI script for migration via @code{PUT}. However, with common web
|
|
servers there is no advantage to this solution, because web servers such as
|
|
Apache
|
|
require explicit activation of a special @code{PUT} script.
|
|
|
|
@item
|
|
@cite{Agent Tcl} pursues a different course; it relies on a dedicated server
|
|
process with a dedicated protocol specialized for receiving mobile agents.
|
|
@end itemize
|
|
|
|
Our agent example abuses a common web server as a migration tool. So, it needs a
|
|
universal CGI script on the receiving side (the web server). The receiving script is
|
|
activated with a @code{POST} request when placed into a location like
|
|
@file{/httpd/cgi-bin/PostAgent.sh}.
|
|
|
|
@example
|
|
@c file eg/network/PostAgent.sh
|
|
#!/bin/sh
|
|
MobAg=/tmp/MobileAgent.$$
|
|
# direct script to mobile agent file
|
|
cat > $MobAg
|
|
# execute agent concurrently
|
|
gawk -f $MobAg $MobAg > /dev/null &
|
|
# HTTP header, terminator and body
|
|
gawk 'BEGIN @{ print "\r\nAgent started" @}'
|
|
rm $MobAg # delete script file of agent
|
|
@c endfile
|
|
@end example
|
|
|
|
By making its process id (@code{$$}) part of the unique @value{FN}, the
|
|
script avoids conflicts between concurrent instances of the script.
|
|
First, all lines
|
|
from standard input (the mobile agent's source code) are copied into
|
|
this unique file. Then, the agent is started as a concurrent process
|
|
and a short message reporting this fact is sent to the submitting client.
|
|
Finally, the script file of the mobile agent is removed because it is
|
|
no longer needed. Although it is a short script, there are several noteworthy
|
|
points:
|
|
|
|
@table @asis
|
|
@item Security
|
|
@emph{There is none}. In fact, the CGI script should never
|
|
be made available on a server that is part of the Internet because everyone
|
|
would be allowed to execute arbitrary commands with it. This behavior is
|
|
acceptable only when performing rapid prototyping.
|
|
|
|
@item Self-Reference
|
|
Each migrating instance of an agent is started
|
|
in a way that enables it to read its own source code from standard input
|
|
and use the code for subsequent
|
|
migrations. This is necessary because it needs to treat the agent's code
|
|
as data to transmit. @command{gawk} is not the ideal language for such
|
|
a job. Lisp and Tcl are more suitable because they do not make a distinction
|
|
between program code and data.
|
|
|
|
@item Independence
|
|
After migration, the agent is not linked to its
|
|
former home in any way. By reporting @samp{Agent started}, it waves
|
|
``Goodbye'' to its origin. The originator may choose to terminate or not.
|
|
@end table
|
|
|
|
@cindex Lisp
|
|
The originating agent itself is started just like any other command-line
|
|
script, and reports the results on standard output. By letting the name
|
|
of the original host migrate with the agent, the agent that migrates
|
|
to a host far away from its origin can report the result back home.
|
|
Having arrived at the end of the journey, the agent establishes
|
|
a connection and reports the results. This is the reason for
|
|
determining the name of the host with @samp{uname -n} and storing it
|
|
in @code{MyOrigin} for later use. We may also set variables with the
|
|
@option{-v} option from the command line. This interactivity is only
|
|
of importance in the context of starting a mobile agent; therefore this
|
|
@code{BEGIN} pattern and its action do not take part in migration:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
BEGIN @{
|
|
if (ARGC != 2) @{
|
|
print "MOBAG - a simple mobile agent"
|
|
print "CALL:\n gawk -f mobag.awk mobag.awk"
|
|
print "IN:\n the name of this script as a command-line parameter"
|
|
print "PARAM:\n -v MyOrigin=myhost.com"
|
|
print "OUT:\n the result on stdout"
|
|
print "JK 29.03.1998 01.04.1998"
|
|
exit
|
|
@}
|
|
if (MyOrigin == "") @{
|
|
"uname -n" | getline MyOrigin
|
|
close("uname -n")
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Since @command{gawk} cannot manipulate and transmit parts of the program
|
|
directly, the source code is read and stored in strings.
|
|
Therefore, the program scans itself for
|
|
the beginning and the ending of functions.
|
|
Each line in between is appended to the code string until the end of
|
|
the function has been reached. A special case is this part of the program
|
|
itself. It is not a function.
|
|
Placing a similar framework around it causes it to be treated
|
|
like a function. Notice that this mechanism works for all the
|
|
functions of the source code, but it cannot guarantee that the order
|
|
of the functions is preserved during migration:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
#ReadMySelf
|
|
/^function / @{ FUNC = $2 @}
|
|
/^END/ || /^#ReadMySelf/ @{ FUNC = $1 @}
|
|
FUNC != "" @{ MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 @}
|
|
(FUNC != "") && (/^@}/ || /^#EndOfMySelf/) \
|
|
@{ FUNC = "" @}
|
|
#EndOfMySelf
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The web server code in
|
|
@ref{Interacting Service, ,A Web Service with Interaction},
|
|
was first developed as a site-independent core. Likewise, the
|
|
@command{gawk}-based mobile agent
|
|
starts with an agent-independent core, to which can be appended
|
|
application-dependent functions. What follows is the only
|
|
application-independent function needed for the mobile agent:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
function migrate(Destination, MobCode, Label) @{
|
|
MOBVAR["Label"] = Label
|
|
MOBVAR["Destination"] = Destination
|
|
RS = ORS = "\r\n"
|
|
HttpService = "/inet/tcp/0/" Destination
|
|
for (i in MOBFUN)
|
|
MobCode = (MobCode "\n" MOBFUN[i])
|
|
MobCode = MobCode "\n\nBEGIN @{"
|
|
for (i in MOBVAR)
|
|
MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
|
|
MobCode = MobCode "\n@}\n"
|
|
print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
|
|
print "Content-length:", length(MobCode) ORS |& HttpService
|
|
printf "%s", MobCode |& HttpService
|
|
while ((HttpService |& getline) > 0)
|
|
print $0
|
|
close(HttpService)
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The @code{migrate()} function prepares the
|
|
aforementioned strings containing the program code and transmits them to a
|
|
server. A consequence of this modular approach is that the @code{migrate()}
|
|
function takes some parameters that aren't needed in this application,
|
|
but that will be in future ones. Its mandatory parameter @code{Destination} holds the
|
|
name (or IP address) of the server that the agent wants as a host for its
|
|
code. The optional parameter @code{MobCode} may contain some @command{gawk}
|
|
code that is inserted during migration in front of all other code.
|
|
The optional parameter @code{Label} may contain
|
|
a string that tells the agent what to do in program execution after
|
|
arrival at its new home site. One of the serious obstacles in implementing
|
|
a framework for mobile agents is that it does not suffice to migrate the
|
|
code. It is also necessary to migrate the state of execution of the agent. In
|
|
contrast to @cite{Agent Tcl}, this program does not try to migrate the complete set
|
|
of variables. The following conventions apply:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
Each variable in an agent program is local to the current host and does
|
|
@emph{not} migrate.
|
|
|
|
@item
|
|
The array @code{MOBFUN} shown above is an exception. It is handled
|
|
by the function @code{migrate()} and does migrate with the application.
|
|
|
|
@item
|
|
The other exception is the array @code{MOBVAR}. Each variable that
|
|
takes part in migration has to be an element of this array.
|
|
@code{migrate()} also takes care of this.
|
|
@end itemize
|
|
|
|
Now it's clear what happens to the @code{Label} parameter of the
|
|
function @code{migrate()}. It is copied into @code{MOBVAR["Label"]} and
|
|
travels alongside the other data. Since traveling takes place via HTTP,
|
|
records must be separated with @code{"\r\n"} in @code{RS} and
|
|
@code{ORS} as usual. The code assembly for migration takes place in
|
|
three steps:
|
|
|
|
@itemize @bullet
|
|
@item
|
|
Iterate over @code{MOBFUN} to collect all functions verbatim.
|
|
|
|
@item
|
|
Prepare a @code{BEGIN} pattern and put assignments to mobile
|
|
variables into the action part.
|
|
|
|
@item
|
|
Transmission itself resembles GETURL: the header with the request
|
|
and the @code{Content-length} is followed by the body. In case there is
|
|
any reply over the network, it is read completely and echoed to
|
|
standard output to avoid irritating the server.
|
|
@end itemize
|
|
|
|
The application-independent framework is now almost complete. What follows
|
|
is the @code{END} pattern which executes when the mobile agent has
|
|
finished reading its own code. First, it checks whether it is already
|
|
running on a remote host or not. In case initialization has not yet taken
|
|
place, it starts @code{MyInit()}. Otherwise (later, on a remote host), it
|
|
starts @code{MyJob()}:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
END @{
|
|
if (ARGC != 2) exit # stop when called with wrong parameters
|
|
if (MyOrigin != "") # is this the originating host?
|
|
MyInit() # if so, initialize the application
|
|
else # we are on a host with migrated data
|
|
MyJob() # so we do our job
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
All that's left to extend the framework into a complete application
|
|
is to write two application-specific functions: @code{MyInit()} and
|
|
@code{MyJob()}. Keep in mind that the former is executed once on the
|
|
originating host, while the latter is executed after each migration:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
function MyInit() @{
|
|
MOBVAR["MyOrigin"] = MyOrigin
|
|
MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
|
|
split(MOBVAR["Machines"], Machines) # which host is the first?
|
|
migrate(Machines[1], "", "") # go to the first host
|
|
while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
|
|
print $0 # print result
|
|
close("/inet/tcp/8080/0/0")
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
As mentioned earlier, this agent takes the name of its origin
|
|
(@code{MyOrigin}) with it. Then, it takes the name of its first
|
|
destination and goes there for further work. Notice that this name has
|
|
the port number of the web server appended to the name of the server,
|
|
because the function @code{migrate()} needs it this way to create
|
|
the @code{HttpService} variable. Finally, it waits for the result to arrive.
|
|
The @code{MyJob()} function runs on the remote host:
|
|
|
|
@smallexample
|
|
@c file eg/network/mobag.awk
|
|
function MyJob() @{
|
|
# forget this host
|
|
sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
|
|
MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
|
|
while (("who" | getline) > 0) # who is logged in?
|
|
MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
|
|
close("who")
|
|
if (index(MOBVAR["Machines"], "/") > 0) @{ # any more machines to visit?
|
|
split(MOBVAR["Machines"], Machines) # which host is next?
|
|
migrate(Machines[1], "", "") # go there
|
|
@} else @{ # no more machines
|
|
gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
|
|
print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
|
|
close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
After migrating, the first thing to do in @code{MyJob()} is to delete
|
|
the name of the current host from the list of hosts to visit. Now, it
|
|
is time to start the real work by appending the host's name to the
|
|
result string, and reading line by line who is logged in on this host.
|
|
A very annoying circumstance is the fact that the elements of
|
|
@code{MOBVAR} cannot hold the newline character (@code{"\n"}). If they
|
|
did, migration of this string would not work because the string wouldn't
|
|
obey the syntax rule for a string in @command{gawk}.
|
|
@code{SUBSEP} is used as a temporary replacement.
|
|
|
|
If the list of hosts to visit holds
|
|
at least one more entry, the agent migrates to that place to go on
|
|
working there. Otherwise, we replace the @code{SUBSEP}s
|
|
with a newline character in the resulting string, and report it to
|
|
the originating host, whose name is stored in @code{MOBVAR["MyOrigin"]}.
|
|
|
|
@node STOXPRED, PROTBASE, MOBAGWHO, Some Applications and Techniques
|
|
@section STOXPRED: Stock Market Prediction As A Service
|
|
@cindex STOXPRED program
|
|
@cindex Yahoo!
|
|
@quotation
|
|
@i{Far out in the uncharted backwaters of the unfashionable end of
|
|
the Western Spiral arm of the Galaxy lies a small unregarded yellow sun.}
|
|
|
|
@i{Orbiting this at a distance of roughly ninety-two million miles is an
|
|
utterly insignificant little blue-green planet whose ape-descendent life
|
|
forms are so amazingly primitive that they still think digital watches are
|
|
a pretty neat idea.}
|
|
|
|
@i{This planet has --- or rather had --- a problem, which was this:
|
|
most of the people living on it were unhappy for pretty much of the time.
|
|
Many solutions were suggested for this problem, but most of these were
|
|
largely concerned with the movements of small green pieces of paper,
|
|
which is odd because it wasn't the small green pieces of paper that
|
|
were unhappy.} @*
|
|
@author Douglas Adams, @cite{The Hitch Hiker's Guide to the Galaxy}
|
|
@end quotation
|
|
|
|
@cindex @command{cron} utility
|
|
Valuable services on the Internet are usually @emph{not} implemented
|
|
as mobile agents. There are much simpler ways of implementing services.
|
|
All Unix systems provide, for example, the @command{cron} service.
|
|
Unix system users can write a list of tasks to be done each day, each
|
|
week, twice a day, or just once. The list is entered into a file named
|
|
@file{crontab}. For example, to distribute a newsletter on a daily
|
|
basis this way, use @command{cron} for calling a script each day early
|
|
in the morning:
|
|
|
|
@example
|
|
# run at 8 am on weekdays, distribute the newsletter
|
|
0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
|
|
@end example
|
|
|
|
The script first looks for interesting information on the Internet,
|
|
assembles it in a nice form and sends the results via email to
|
|
the customers.
|
|
|
|
The following is an example of a primitive
|
|
newsletter on stock market prediction. It is a report which first
|
|
tries to predict the change of each share in the Dow Jones Industrial
|
|
Index for the particular day. Then it mentions some especially
|
|
promising shares as well as some shares which look remarkably bad
|
|
on that day. The report ends with the usual disclaimer which tells
|
|
every child @emph{not} to try this at home and hurt anybody.
|
|
@cindex Dow Jones Industrial Index
|
|
|
|
@smallexample
|
|
Good morning Uncle Scrooge,
|
|
|
|
This is your daily stock market report for Monday, October 16, 2000.
|
|
Here are the predictions for today:
|
|
|
|
AA neutral
|
|
GE up
|
|
JNJ down
|
|
MSFT neutral
|
|
@dots{}
|
|
UTX up
|
|
DD down
|
|
IBM up
|
|
MO down
|
|
WMT up
|
|
DIS up
|
|
INTC up
|
|
MRK down
|
|
XOM down
|
|
EK down
|
|
IP down
|
|
|
|
The most promising shares for today are these:
|
|
|
|
INTC http://biz.yahoo.com/n/i/intc.html
|
|
|
|
The stock shares to avoid today are these:
|
|
|
|
EK http://biz.yahoo.com/n/e/ek.html
|
|
IP http://biz.yahoo.com/n/i/ip.html
|
|
DD http://biz.yahoo.com/n/d/dd.html
|
|
@dots{}
|
|
@end smallexample
|
|
|
|
The script as a whole is rather long. In order to ease the pain of
|
|
studying other people's source code, we have broken the script
|
|
up into meaningful parts which are invoked one after the other.
|
|
The basic structure of the script is as follows:
|
|
|
|
@example
|
|
@c file eg/network/stoxpred.awk
|
|
BEGIN @{
|
|
Init()
|
|
ReadQuotes()
|
|
CleanUp()
|
|
Prediction()
|
|
Report()
|
|
SendMail()
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
The earlier parts store data into variables and arrays which are
|
|
subsequently used by later parts of the script. The @code{Init()} function
|
|
first checks if the script is invoked correctly (without any parameters).
|
|
If not, it informs the user of the correct usage. What follows are preparations
|
|
for the retrieval of the historical quote data. The names of the 30 stock
|
|
shares are stored in an array @code{name} along with the current date
|
|
in @code{day}, @code{month}, and @code{year}.
|
|
|
|
All users who are separated
|
|
from the Internet by a firewall and have to direct their Internet accesses
|
|
to a proxy must supply the name of the proxy to this script with the
|
|
@samp{-v Proxy=@var{name}} option. For most users, the default proxy and
|
|
port number should suffice.
|
|
|
|
@example
|
|
@c file eg/network/stoxpred.awk
|
|
function Init() @{
|
|
if (ARGC != 1) @{
|
|
print "STOXPRED - daily stock share prediction"
|
|
print "IN:\n no parameters, nothing on stdin"
|
|
print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
|
|
print "OUT:\n commented predictions as email"
|
|
print "JK 09.10.2000"
|
|
exit
|
|
@}
|
|
# Remember ticker symbols from Dow Jones Industrial Index
|
|
StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
|
|
SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
|
|
MRK XOM EK IP", name);
|
|
# Remember the current date as the end of the time series
|
|
day = strftime("%d")
|
|
month = strftime("%m")
|
|
year = strftime("%Y")
|
|
if (Proxy == "") Proxy = "chart.yahoo.com"
|
|
if (ProxyPort == 0) ProxyPort = 80
|
|
YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
|
|
@}
|
|
@c endfile
|
|
@end example
|
|
|
|
@cindex CSV format
|
|
There are two really interesting parts in the script. One is the
|
|
function which reads the historical stock quotes from an Internet
|
|
server. The other is the one that does the actual prediction. In
|
|
the following function we see how the quotes are read from the
|
|
Yahoo server. The data which comes from the server is in
|
|
CSV format (comma-separated values):
|
|
|
|
@example
|
|
@c file eg/network/stoxdata.txt
|
|
Date,Open,High,Low,Close,Volume
|
|
9-Oct-00,22.75,22.75,21.375,22.375,7888500
|
|
6-Oct-00,23.8125,24.9375,21.5625,22,10701100
|
|
5-Oct-00,24.4375,24.625,23.125,23.50,5810300
|
|
@c endfile
|
|
@end example
|
|
|
|
Lines contain values of the same time instant, whereas columns are
|
|
separated by commas and contain the kind of data that is described
|
|
in the header (first) line. At first, @command{gawk} is instructed to
|
|
separate columns by commas (@samp{FS = ","}). In the loop that follows,
|
|
a connection to the Yahoo server is first opened, then a download takes
|
|
place, and finally the connection is closed. All this happens once for
|
|
each ticker symbol. In the body of this loop, an Internet address is
|
|
built up as a string according to the rules of the Yahoo server. The
|
|
starting and ending date are chosen to be exactly the same, but one year
|
|
apart in the past. All the action is initiated within the @code{printf}
|
|
command which transmits the request for data to the Yahoo server.
|
|
|
|
In the inner loop, the server's data is first read and then scanned
|
|
line by line. Only lines which have six columns and the name of a month
|
|
in the first column contain relevant data. This data is stored
|
|
in the two-dimensional array @code{quote}; one dimension
|
|
being time, the other being the ticker symbol. During retrieval of the
|
|
first stock's data, the calendar names of the time instances are stored
|
|
in the array @code{day} because we need them later.
|
|
|
|
@smallexample
|
|
@c file eg/network/stoxpred.awk
|
|
function ReadQuotes() @{
|
|
# Retrieve historical data for each ticker symbol
|
|
FS = ","
|
|
for (stock = 1; stock <= StockCount; stock++) @{
|
|
URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
|
|
"&a=" month "&b=" day "&c=" year-1 \
|
|
"&d=" month "&e=" day "&f=" year \
|
|
"g=d&q=q&y=0&z=" name[stock] "&x=.csv"
|
|
printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
|
|
while ((YahooData |& getline) > 0) @{
|
|
if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) @{
|
|
if (stock == 1)
|
|
days[++daycount] = $1;
|
|
quote[$1, stock] = $5
|
|
@}
|
|
@}
|
|
close(YahooData)
|
|
@}
|
|
FS = " "
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Now that we @emph{have} the data, it can be checked once again to make sure
|
|
that no individual stock is missing or invalid, and that all the stock quotes are
|
|
aligned correctly. Furthermore, we renumber the time instances. The
|
|
most recent day gets day number 1 and all other days get consecutive
|
|
numbers. All quotes are rounded toward the nearest whole number in US Dollars.
|
|
|
|
@smallexample
|
|
@c file eg/network/stoxpred.awk
|
|
function CleanUp() @{
|
|
# clean up time series; eliminate incomplete data sets
|
|
for (d = 1; d <= daycount; d++) @{
|
|
for (stock = 1; stock <= StockCount; stock++)
|
|
if (! ((days[d], stock) in quote))
|
|
stock = StockCount + 10
|
|
if (stock > StockCount + 1)
|
|
continue
|
|
datacount++
|
|
for (stock = 1; stock <= StockCount; stock++)
|
|
data[datacount, stock] = int(0.5 + quote[days[d], stock])
|
|
@}
|
|
delete quote
|
|
delete days
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Now we have arrived at the second really interesting part of the whole affair.
|
|
What we present here is a very primitive prediction algorithm:
|
|
@emph{If a stock fell yesterday, assume it will also fall today; if
|
|
it rose yesterday, assume it will rise today}. (Feel free to replace this
|
|
algorithm with a smarter one.) If a stock changed in the same direction
|
|
on two consecutive days, this is an indication which should be highlighted.
|
|
Two-day advances are stored in @code{hot} and two-day declines in
|
|
@code{avoid}.
|
|
|
|
The rest of the function is a sanity check. It counts the number of
|
|
correct predictions in relation to the total number of predictions
|
|
one could have made in the year before.
|
|
|
|
@smallexample
|
|
@c file eg/network/stoxpred.awk
|
|
function Prediction() @{
|
|
# Predict each ticker symbol by prolonging yesterday's trend
|
|
for (stock = 1; stock <= StockCount; stock++) @{
|
|
if (data[1, stock] > data[2, stock]) @{
|
|
predict[stock] = "up"
|
|
@} else if (data[1, stock] < data[2, stock]) @{
|
|
predict[stock] = "down"
|
|
@} else @{
|
|
predict[stock] = "neutral"
|
|
@}
|
|
if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
|
|
hot[stock] = 1
|
|
if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
|
|
avoid[stock] = 1
|
|
@}
|
|
# Do a plausibility check: how many predictions proved correct?
|
|
for (s = 1; s <= StockCount; s++) @{
|
|
for (d = 1; d <= datacount-2; d++) @{
|
|
if (data[d+1, s] > data[d+2, s]) @{
|
|
UpCount++
|
|
@} else if (data[d+1, s] < data[d+2, s]) @{
|
|
DownCount++
|
|
@} else @{
|
|
NeutralCount++
|
|
@}
|
|
if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
|
|
((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
|
|
((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
|
|
CorrectCount++
|
|
@}
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
At this point the hard work has been done: the array @code{predict}
|
|
contains the predictions for all the ticker symbols. It is up to the
|
|
function @code{Report()} to find some nice words to present the
|
|
desired information.
|
|
|
|
@smallexample
|
|
@c file eg/network/stoxpred.awk
|
|
function Report() @{
|
|
# Generate report
|
|
report = "\nThis is your daily "
|
|
report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
|
|
report = report "Here are the predictions for today:\n\n"
|
|
for (stock = 1; stock <= StockCount; stock++)
|
|
report = report "\t" name[stock] "\t" predict[stock] "\n"
|
|
for (stock in hot) @{
|
|
if (HotCount++ == 0)
|
|
report = report "\nThe most promising shares for today are these:\n\n"
|
|
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
|
|
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
|
|
@}
|
|
for (stock in avoid) @{
|
|
if (AvoidCount++ == 0)
|
|
report = report "\nThe stock shares to avoid today are these:\n\n"
|
|
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
|
|
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
|
|
@}
|
|
report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
|
|
report = report " losers. When using this kind\nof prediction scheme for"
|
|
report = report " the 12 months which lie behind us,\nwe get " UpCount
|
|
report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
|
|
report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
|
|
report = report " predictions " CorrectCount " proved correct next day.\n"
|
|
report = report "A success rate of "\
|
|
int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
|
|
report = report "Random choice would have produced a 33% success rate.\n"
|
|
report = report "Disclaimer: Like every other prediction of the stock\n"
|
|
report = report "market, this report is, of course, complete nonsense.\n"
|
|
report = report "If you are stupid enough to believe these predictions\n"
|
|
report = report "you should visit a doctor who can treat your ailment."
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The function @code{SendMail()} goes through the list of customers and opens
|
|
a pipe to the @command{mail} command for each of them. Each one receives an
|
|
email message with a proper subject heading and is addressed with his full name.
|
|
|
|
@smallexample
|
|
@c file eg/network/stoxpred.awk
|
|
function SendMail() @{
|
|
# send report to customers
|
|
customer["uncle.scrooge@@ducktown.gov"] = "Uncle Scrooge"
|
|
customer["more@@utopia.org" ] = "Sir Thomas More"
|
|
customer["spinoza@@denhaag.nl" ] = "Baruch de Spinoza"
|
|
customer["marx@@highgate.uk" ] = "Karl Marx"
|
|
customer["keynes@@the.long.run" ] = "John Maynard Keynes"
|
|
customer["bierce@@devil.hell.org" ] = "Ambrose Bierce"
|
|
customer["laplace@@paris.fr" ] = "Pierre Simon de Laplace"
|
|
for (c in customer) @{
|
|
MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
|
|
print "Good morning " customer[c] "," | MailPipe
|
|
print report "\n.\n" | MailPipe
|
|
close(MailPipe)
|
|
@}
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
Be patient when running the script by hand.
|
|
Retrieving the data for all the ticker symbols and sending the emails
|
|
may take several minutes to complete, depending upon network traffic
|
|
and the speed of the available Internet link.
|
|
The quality of the prediction algorithm is likely to be disappointing.
|
|
Try to find a better one.
|
|
Should you find one with a success rate of more than 50%, please tell
|
|
us about it! It is only for the sake of curiosity, of course. @code{:-)}
|
|
|
|
@node PROTBASE, , STOXPRED, Some Applications and Techniques
|
|
@section PROTBASE: Searching Through A Protein Database
|
|
@cindex PROTBASE
|
|
@cindex NCBI, National Center for Biotechnology Information
|
|
@cindex BLAST, Basic Local Alignment Search Tool
|
|
@cindex Hoare, C.A.R.
|
|
@quotation
|
|
@i{Inside every large problem is a small
|
|
problem struggling to get out.}@footnote{What C.A.R.@: Hoare
|
|
actually said was ``Inside every large program is a
|
|
small program struggling to get out.''}
|
|
@author With apologies to C.A.R.@: Hoare
|
|
@end quotation
|
|
|
|
Yahoo's database of stock market data is just one among the many large
|
|
databases on the Internet. Another one is located at NCBI
|
|
(National Center for Biotechnology
|
|
Information). Established in 1988 as a national resource for molecular
|
|
biology information, NCBI creates public databases, conducts research
|
|
in computational biology, develops software tools for analyzing genome
|
|
data, and disseminates biomedical information. In this section, we
|
|
look at one of NCBI's public services, which is called BLAST
|
|
(Basic Local Alignment Search Tool).
|
|
|
|
You probably know that the information necessary for reproducing living
|
|
cells is encoded in the genetic material of the cells. The genetic material
|
|
is a very long chain of four base nucleotides. It is the order of
|
|
appearance (the sequence) of nucleotides which contains the information
|
|
about the substance to be produced. Scientists in biotechnology often
|
|
find a specific fragment, determine the nucleotide sequence, and need
|
|
to know where the sequence at hand comes from.
|
|
|
|
This is where the large
|
|
databases enter the game. At NCBI, databases store the knowledge
|
|
about which sequences have ever been found and where they have been found.
|
|
When the scientist sends his sequence to the BLAST service, the server
|
|
looks for regions of genetic material in its database which
|
|
look the most similar to the delivered nucleotide sequence. After a
|
|
search time of some seconds or minutes the server sends an answer to
|
|
the scientist. In order to make access simple, NCBI chose to offer
|
|
their database service through popular Internet protocols. There are
|
|
four basic ways to use the so-called BLAST services:
|
|
|
|
@c FIXME: Is all of this still true?
|
|
@itemize @bullet
|
|
@item
|
|
The easiest way to use BLAST is through the web. Users may simply point
|
|
their browsers at the NCBI home page
|
|
and link to the BLAST pages.
|
|
NCBI provides a stable URL that may be used to perform BLAST searches
|
|
without interactive use of a web browser. This is what we will do later
|
|
in this section.
|
|
A demonstration client
|
|
and a @file{README} file demonstrate how to access this URL.
|
|
|
|
@item
|
|
Currently,
|
|
@command{blastcl3} is the standard network BLAST client.
|
|
You can download @command{blastcl3} from the
|
|
anonymous FTP location.
|
|
|
|
@item
|
|
BLAST 2.0 can be run locally as a full executable and can be used to run
|
|
BLAST searches against private local databases, or downloaded copies of the
|
|
NCBI databases. BLAST 2.0 executables may be found on the NCBI
|
|
anonymous FTP server.
|
|
|
|
@item
|
|
The NCBI BLAST Email server is the best option for people without convenient
|
|
access to the web. A similarity search can be performed by sending a properly
|
|
formatted mail message containing the nucleotide or protein query sequence to
|
|
@email{blast@@ncbi.nlm.nih.gov}. The query sequence is compared against the
|
|
specified database using the BLAST algorithm and the results are returned in
|
|
an email message. For more information on formulating email BLAST searches,
|
|
you can send a message consisting of the word ``HELP'' to the same address,
|
|
@email{blast@@ncbi.nlm.nih.gov}.
|
|
@end itemize
|
|
|
|
Our starting point is the demonstration client mentioned in the first option.
|
|
The @file{README} file that comes along with the client explains the whole
|
|
process in a nutshell. In the rest of this section, we first show
|
|
what such requests look like. Then we show how to use @command{gawk} to
|
|
implement a client in about 10 lines of code. Finally, we show how to
|
|
interpret the result returned from the service.
|
|
|
|
Sequences are expected to be represented in the standard
|
|
IUB/IUPAC amino acid and nucleic acid codes,
|
|
with these exceptions: lower-case letters are accepted and are mapped
|
|
into upper-case; a single hyphen or dash can be used to represent a gap
|
|
of indeterminate length; and in amino acid sequences, @samp{U} and @samp{*}
|
|
are acceptable letters (see below). Before submitting a request, any numerical
|
|
digits in the query sequence should either be removed or replaced by
|
|
appropriate letter codes (e.g., @samp{N} for unknown nucleic acid residue
|
|
or @samp{X} for unknown amino acid residue).
|
|
The nucleic acid codes supported are:
|
|
|
|
@example
|
|
A --> adenosine M --> A C (amino)
|
|
C --> cytidine S --> G C (strong)
|
|
G --> guanine W --> A T (weak)
|
|
T --> thymidine B --> G T C
|
|
U --> uridine D --> G A T
|
|
R --> G A (purine) H --> A C T
|
|
Y --> T C (pyrimidine) V --> G C A
|
|
K --> G T (keto) N --> A G C T (any)
|
|
- gap of indeterminate length
|
|
@end example
|
|
|
|
Now you know the alphabet of nucleotide sequences. The last two lines
|
|
of the following example query show such a sequence, which is obviously
|
|
made up only of elements of the alphabet just described. Store this example
|
|
query into a file named @file{protbase.request}. You are now ready to send
|
|
it to the server with the demonstration client.
|
|
|
|
@example
|
|
@c file eg/network/protbase.request
|
|
PROGRAM blastn
|
|
DATALIB month
|
|
EXPECT 0.75
|
|
BEGIN
|
|
>GAWK310 the gawking gene GNU AWK
|
|
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
|
|
caccaccatggacagcaaa
|
|
@c endfile
|
|
@end example
|
|
|
|
@cindex FASTA/Pearson format
|
|
The actual search request begins with the mandatory parameter @samp{PROGRAM}
|
|
in the first column followed by the value @samp{blastn} (the name of the
|
|
program) for searching nucleic acids. The next line contains the mandatory
|
|
search parameter @samp{DATALIB} with the value @samp{month} for the newest
|
|
nucleic acid sequences. The third line contains an optional @samp{EXPECT}
|
|
parameter and the value desired for it. The fourth line contains the
|
|
mandatory @samp{BEGIN} directive, followed by the query sequence in
|
|
FASTA/Pearson format.
|
|
Each line of information must be less than 80 characters in length.
|
|
|
|
The ``month'' database contains all new or revised sequences released in the
|
|
last 30 days and is useful for searching against new sequences.
|
|
There are five different blast programs, @command{blastn} being the one that
|
|
compares a nucleotide query sequence against a nucleotide sequence database.
|
|
|
|
The last server directive that must appear in every request is the
|
|
@samp{BEGIN} directive. The query sequence should immediately follow the
|
|
@samp{BEGIN} directive and must appear in FASTA/Pearson format.
|
|
A sequence in
|
|
FASTA/Pearson format begins with a single-line description.
|
|
The description line, which is required, is distinguished from the lines of
|
|
sequence data that follow it by having a greater-than (@samp{>}) symbol
|
|
in the first column. For the purposes of the BLAST server, the text of
|
|
the description is arbitrary.
|
|
|
|
If you prefer to use a client written in @command{gawk}, just store the following
|
|
10 lines of code into a file named @file{protbase.awk} and use this client
|
|
instead. Invoke it with @samp{gawk -f protbase.awk protbase.request}.
|
|
Then wait a minute and watch the result coming in. In order to replicate
|
|
the demonstration client's behavior as closely as possible, this client
|
|
does not use a proxy server. We could also have extended the client program
|
|
in @ref{GETURL, ,Retrieving Web Pages}, to implement the client request from
|
|
@file{protbase.awk} as a special case.
|
|
|
|
@smallexample
|
|
@c file eg/network/protbase.awk
|
|
@{ request = request "\n" $0 @}
|
|
|
|
END @{
|
|
BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
|
|
printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
|
|
printf "Content-Length: " length(request) "\n\n" |& BLASTService
|
|
printf request |& BLASTService
|
|
while ((BLASTService |& getline) > 0)
|
|
print $0
|
|
close(BLASTService)
|
|
@}
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
The demonstration client from NCBI is 214 lines long (written in C) and
|
|
it is not immediately obvious what it does. Our client is so short that
|
|
it @emph{is} obvious what it does. First it loops over all lines of the
|
|
query and stores the whole query into a variable. Then the script
|
|
establishes an Internet connection to the NCBI server and transmits the
|
|
query by framing it with a proper HTTP request. Finally it receives
|
|
and prints the complete result coming from the server.
|
|
|
|
Now, let us look at the result. It begins with an HTTP header, which you
|
|
can ignore. Then there are some comments about the query having been
|
|
filtered to avoid spuriously high scores. After this, there is a reference
|
|
to the paper that describes the software being used for searching the data
|
|
base. After a repetition of the original query's description we find the
|
|
list of significant alignments:
|
|
|
|
@smallexample
|
|
@c file eg/network/protbase.result
|
|
Sequences producing significant alignments: (bits) Value
|
|
|
|
gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
|
|
gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
|
|
emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
|
|
emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
|
|
emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
|
|
emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
|
|
gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
|
|
@c endfile
|
|
@end smallexample
|
|
|
|
This means that the query sequence was found in seven human chromosomes.
|
|
But the value 0.20 (20%) means that the probability of an accidental match
|
|
is rather high (20%) in all cases and should be taken into account.
|
|
You may wonder what the first column means. It is a key to the specific
|
|
database in which this occurrence was found. The unique sequence identifiers
|
|
reported in the search results can be used as sequence retrieval keys
|
|
via the NCBI server. The syntax of sequence header lines used by the NCBI
|
|
BLAST server depends on the database from which each sequence was obtained.
|
|
The table below lists the identifiers for the databases from which the
|
|
sequences were derived.
|
|
|
|
@ifinfo
|
|
@example
|
|
Database Name Identifier Syntax
|
|
============================ ========================
|
|
GenBank gb|accession|locus
|
|
EMBL Data Library emb|accession|locus
|
|
DDBJ, DNA Database of Japan dbj|accession|locus
|
|
NBRF PIR pir||entry
|
|
Protein Research Foundation prf||name
|
|
SWISS-PROT sp|accession|entry name
|
|
Brookhaven Protein Data Bank pdb|entry|chain
|
|
Kabat's Sequences of Immuno@dots{} gnl|kabat|identifier
|
|
Patents pat|country|number
|
|
GenInfo Backbone Id bbs|number
|
|
@end example
|
|
@end ifinfo
|
|
|
|
@ifnotinfo
|
|
@multitable {Kabat's Sequences of Immuno@dots{}} {@code{@w{sp|accession|entry name}}}
|
|
@item GenBank @tab @code{gb|accession|locus}
|
|
@item EMBL Data Library @tab @code{emb|accession|locus}
|
|
@item DDBJ, DNA Database of Japan @tab @code{dbj|accession|locus}
|
|
@item NBRF PIR @tab @code{pir||entry}
|
|
@item Protein Research Foundation @tab @code{prf||name}
|
|
@item SWISS-PROT @tab @code{@w{sp|accession|entry name}}
|
|
@item Brookhaven Protein Data Bank @tab @code{pdb|entry|chain}
|
|
@item Kabat's Sequences of Immuno@dots{} @tab @code{gnl|kabat|identifier}
|
|
@item Patents @tab @code{pat|country|number}
|
|
@item GenInfo Backbone Id @tab @code{bbs|number}
|
|
@end multitable
|
|
@end ifnotinfo
|
|
|
|
|
|
For example, an identifier might be @samp{gb|AC021182.14|AC021182}, where the
|
|
@samp{gb} tag indicates that the identifier refers to a GenBank sequence,
|
|
@samp{AC021182.14} is its GenBank ACCESSION, and @samp{AC021182} is the GenBank LOCUS.
|
|
The identifier contains no spaces, so that a space indicates the end of the
|
|
identifier.
|
|
|
|
Let us continue in the result listing. Each of the seven alignments mentioned
|
|
above is subsequently described in detail. We will have a closer look at
|
|
the first of them.
|
|
|
|
@smallexample
|
|
>gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
|
|
unordered pieces
|
|
Length = 176383
|
|
|
|
Score = 38.2 bits (19), Expect = 0.20
|
|
Identities = 19/19 (100%)
|
|
Strand = Plus / Plus
|
|
|
|
Query: 35 tggtgaagtgtgtttcttg 53
|
|
|||||||||||||||||||
|
|
Sbjct: 69786 tggtgaagtgtgtttcttg 69804
|
|
@end smallexample
|
|
|
|
This alignment was located on the human chromosome 7. The fragment on which
|
|
part of the query was found had a total length of 176383. Only 19 of the
|
|
nucleotides matched and the matching sequence ran from character 35 to 53
|
|
in the query sequence and from 69786 to 69804 in the fragment on chromosome 7.
|
|
If you are still reading at this point, you are probably interested in finding
|
|
out more about Computational Biology and you might appreciate the following
|
|
hints.
|
|
|
|
@cindex Computational Biology
|
|
@cindex Bioinformatics
|
|
@enumerate
|
|
@item
|
|
There is a book called @cite{Introduction to Computational Biology}
|
|
by Michael S. Waterman, which is worth reading if you are seriously
|
|
interested. You can find a good
|
|
book review
|
|
on the Internet.
|
|
|
|
@item
|
|
While Waterman's book explains the algorithms employed internally
|
|
in the database search engines, most practitioners prefer to approach
|
|
the subject differently. The applied side of Computational Biology is
|
|
called Bioinformatics, and emphasizes the tools available for day-to-day
|
|
work as well as how to actually @emph{use} them. One of the very few affordable
|
|
books on Bioinformatics is
|
|
@cite{Developing Bioinformatics Computer Skills}.
|
|
|
|
@item
|
|
The sequences @emph{gawk} and @emph{gnuawk} are in widespread use in
|
|
the genetic material of virtually every earthly living being. Let us
|
|
take this as a clear indication that the divine creator has intended
|
|
@command{gawk} to prevail over other scripting languages such as @samp{perl},
|
|
@samp{tcl}, or @samp{python} which are not even proper sequences. (:-)
|
|
@end enumerate
|
|
|
|
@node Links, GNU Free Documentation License, Some Applications and Techniques, Top
|
|
@chapter Related Links
|
|
|
|
This section lists the URLs for various items discussed in this @value{DOCUMENT}.
|
|
They are presented in the order in which they appear.
|
|
|
|
@table @asis
|
|
|
|
@item @cite{Internet Programming with Python}
|
|
@uref{http://cewing.github.io/training.python_web/html/index.html}
|
|
|
|
@item @cite{Advanced Perl Programming}
|
|
@uref{http://www.oreilly.com/catalog/advperl}
|
|
|
|
@item @cite{Web Client Programming with Perl}
|
|
@uref{http://www.oreilly.com/catalog/webclient}
|
|
|
|
@item Richard Stevens's home page and book
|
|
@uref{http://www.kohala.com/start}
|
|
|
|
@item Volume III of @cite{Internetworking with TCP/IP}, by Comer and Stevens
|
|
@uref{http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html}
|
|
|
|
@item XBM Graphics File Format
|
|
@uref{https://en.wikipedia.org/wiki/X_BitMap}
|
|
|
|
@item GNUPlot
|
|
@uref{http://www.gnuplot.info}
|
|
|
|
@item Mark Humphrys' Eliza page
|
|
@uref{https://computing.dcu.ie/~humphrys/eliza.html}
|
|
|
|
@item Eliza on Wikipedia
|
|
@uref{https://en.wikipedia.org/wiki/ELIZA}
|
|
|
|
@item Java versions of Eliza with source code
|
|
@uref{https://github.com/codeanticode/eliza}
|
|
|
|
@item Loebner Contest
|
|
@uref{https://www.ocf.berkeley.edu/~arihuang/academic/research/loebner.html}
|
|
|
|
@item Tck/Tk Information
|
|
@uref{https://en.wikipedia.org/wiki/Tcl}
|
|
|
|
@item Intel 80x86 Processors
|
|
@item Embedded PCs
|
|
@uref{https://en.wikipedia.org/wiki/Embedded_system}
|
|
|
|
@item AMD Elan Processors
|
|
@uref{https://en.wikipedia.org/wiki/Am5x86}
|
|
|
|
@item XINU
|
|
@uref{https://xinu.cs.purdue.edu}
|
|
|
|
@item GNU/Linux
|
|
@uref{https://en.wikipedia.org/wiki/GNU/Linux_naming_controversy}
|
|
|
|
@item MiniSQL
|
|
@uref{https://hughestech.com.au/products/msql}
|
|
|
|
@item Market Share Surveys
|
|
@uref{http://www.netcraft.com/survey}
|
|
|
|
@item @cite{Numerical Recipes in C: The Art of Scientific Computing}
|
|
@uref{http://numerical.recipes/}
|
|
|
|
@item VRML
|
|
@uref{https://en.wikipedia.org/wiki/VRML}
|
|
|
|
@item The UMBC Agent Web
|
|
@uref{https://agents.umbc.edu}
|
|
|
|
@item Apache Web Server
|
|
@uref{http://www.apache.org}
|
|
|
|
@item National Center for Biotechnology Information (NCBI)
|
|
@uref{http://www.ncbi.nlm.nih.gov}
|
|
|
|
@item Basic Local Alignment Search Tool (BLAST)
|
|
@uref{https://www.nature.com/scitable/topicpage/basic-local-alignment-search-tool-blast-29096}
|
|
|
|
@item BLAST Pages
|
|
@uref{http://www.ncbi.nlm.nih.gov/BLAST}
|
|
|
|
@item BLAST Demonstration Client
|
|
@uref{http://www.genebee.msu.su/blast/blast_overview.html#Network}
|
|
|
|
@item BLAST anonymous FTP location
|
|
@uref{https://www.ncbi.nlm.nih.gov/books/NBK62345/}
|
|
|
|
@item BLAST 2.0 Executables
|
|
@uref{ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST}
|
|
|
|
@item IUB/IUPAC Amino Acid and Nucleic Acid Codes
|
|
@uref{https://en.wikipedia.org/wiki/Nucleic_acid_notation}
|
|
|
|
@item FASTA/Pearson Format
|
|
@uref{https://de.wikipedia.org/wiki/FASTA-Format}
|
|
|
|
@item Fasta/Pearson Sequence in Java
|
|
@uref{http://www.kazusa.or.jp/java/codon_table_java/}
|
|
|
|
@item Book Review of @cite{Introduction to Computational Biology}
|
|
@uref{https://dl.acm.org/doi/abs/10.1145/332925.332927}
|
|
|
|
@item @cite{Developing Bioinformatics Computer Skills}
|
|
@uref{http://www.oreilly.com/catalog/bioskills/}
|
|
|
|
@end table
|
|
|
|
@c The GNU Free Documentation License.
|
|
@node GNU Free Documentation License, Index, Links, Top
|
|
@unnumbered GNU Free Documentation License
|
|
@cindex FDL (Free Documentation License)
|
|
@cindex Free Documentation License (FDL)
|
|
@cindex GNU Free Documentation License
|
|
@center Version 1.3, 3 November 2008
|
|
|
|
@c This file is intended to be included within another document,
|
|
@c hence no sectioning command or @node.
|
|
|
|
@display
|
|
Copyright @copyright{} 2000, 2001, 2002, 2007, 2008 Free Software Foundation, Inc.
|
|
@uref{http://fsf.org/}
|
|
|
|
Everyone is permitted to copy and distribute verbatim copies
|
|
of this license document, but changing it is not allowed.
|
|
@end display
|
|
|
|
@enumerate 0
|
|
@item
|
|
PREAMBLE
|
|
|
|
The purpose of this License is to make a manual, textbook, or other
|
|
functional and useful document @dfn{free} in the sense of freedom: to
|
|
assure everyone the effective freedom to copy and redistribute it,
|
|
with or without modifying it, either commercially or noncommercially.
|
|
Secondarily, this License preserves for the author and publisher a way
|
|
to get credit for their work, while not being considered responsible
|
|
for modifications made by others.
|
|
|
|
This License is a kind of ``copyleft'', which means that derivative
|
|
works of the document must themselves be free in the same sense. It
|
|
complements the GNU General Public License, which is a copyleft
|
|
license designed for free software.
|
|
|
|
We have designed this License in order to use it for manuals for free
|
|
software, because free software needs free documentation: a free
|
|
program should come with manuals providing the same freedoms that the
|
|
software does. But this License is not limited to software manuals;
|
|
it can be used for any textual work, regardless of subject matter or
|
|
whether it is published as a printed book. We recommend this License
|
|
principally for works whose purpose is instruction or reference.
|
|
|
|
@item
|
|
APPLICABILITY AND DEFINITIONS
|
|
|
|
This License applies to any manual or other work, in any medium, that
|
|
contains a notice placed by the copyright holder saying it can be
|
|
distributed under the terms of this License. Such a notice grants a
|
|
world-wide, royalty-free license, unlimited in duration, to use that
|
|
work under the conditions stated herein. The ``Document'', below,
|
|
refers to any such manual or work. Any member of the public is a
|
|
licensee, and is addressed as ``you''. You accept the license if you
|
|
copy, modify or distribute the work in a way requiring permission
|
|
under copyright law.
|
|
|
|
A ``Modified Version'' of the Document means any work containing the
|
|
Document or a portion of it, either copied verbatim, or with
|
|
modifications and/or translated into another language.
|
|
|
|
A ``Secondary Section'' is a named appendix or a front-matter section
|
|
of the Document that deals exclusively with the relationship of the
|
|
publishers or authors of the Document to the Document's overall
|
|
subject (or to related matters) and contains nothing that could fall
|
|
directly within that overall subject. (Thus, if the Document is in
|
|
part a textbook of mathematics, a Secondary Section may not explain
|
|
any mathematics.) The relationship could be a matter of historical
|
|
connection with the subject or with related matters, or of legal,
|
|
commercial, philosophical, ethical or political position regarding
|
|
them.
|
|
|
|
The ``Invariant Sections'' are certain Secondary Sections whose titles
|
|
are designated, as being those of Invariant Sections, in the notice
|
|
that says that the Document is released under this License. If a
|
|
section does not fit the above definition of Secondary then it is not
|
|
allowed to be designated as Invariant. The Document may contain zero
|
|
Invariant Sections. If the Document does not identify any Invariant
|
|
Sections then there are none.
|
|
|
|
The ``Cover Texts'' are certain short passages of text that are listed,
|
|
as Front-Cover Texts or Back-Cover Texts, in the notice that says that
|
|
the Document is released under this License. A Front-Cover Text may
|
|
be at most 5 words, and a Back-Cover Text may be at most 25 words.
|
|
|
|
A ``Transparent'' copy of the Document means a machine-readable copy,
|
|
represented in a format whose specification is available to the
|
|
general public, that is suitable for revising the document
|
|
straightforwardly with generic text editors or (for images composed of
|
|
pixels) generic paint programs or (for drawings) some widely available
|
|
drawing editor, and that is suitable for input to text formatters or
|
|
for automatic translation to a variety of formats suitable for input
|
|
to text formatters. A copy made in an otherwise Transparent file
|
|
format whose markup, or absence of markup, has been arranged to thwart
|
|
or discourage subsequent modification by readers is not Transparent.
|
|
An image format is not Transparent if used for any substantial amount
|
|
of text. A copy that is not ``Transparent'' is called ``Opaque''.
|
|
|
|
Examples of suitable formats for Transparent copies include plain
|
|
@sc{ascii} without markup, Texinfo input format, La@TeX{} input
|
|
format, @acronym{SGML} or @acronym{XML} using a publicly available
|
|
@acronym{DTD}, and standard-conforming simple @acronym{HTML},
|
|
PostScript or @acronym{PDF} designed for human modification. Examples
|
|
of transparent image formats include @acronym{PNG}, @acronym{XCF} and
|
|
@acronym{JPG}. Opaque formats include proprietary formats that can be
|
|
read and edited only by proprietary word processors, @acronym{SGML} or
|
|
@acronym{XML} for which the @acronym{DTD} and/or processing tools are
|
|
not generally available, and the machine-generated @acronym{HTML},
|
|
PostScript or @acronym{PDF} produced by some word processors for
|
|
output purposes only.
|
|
|
|
The ``Title Page'' means, for a printed book, the title page itself,
|
|
plus such following pages as are needed to hold, legibly, the material
|
|
this License requires to appear in the title page. For works in
|
|
formats which do not have any title page as such, ``Title Page'' means
|
|
the text near the most prominent appearance of the work's title,
|
|
preceding the beginning of the body of the text.
|
|
|
|
The ``publisher'' means any person or entity that distributes copies
|
|
of the Document to the public.
|
|
|
|
A section ``Entitled XYZ'' means a named subunit of the Document whose
|
|
title either is precisely XYZ or contains XYZ in parentheses following
|
|
text that translates XYZ in another language. (Here XYZ stands for a
|
|
specific section name mentioned below, such as ``Acknowledgements'',
|
|
``Dedications'', ``Endorsements'', or ``History''.) To ``Preserve the Title''
|
|
of such a section when you modify the Document means that it remains a
|
|
section ``Entitled XYZ'' according to this definition.
|
|
|
|
The Document may include Warranty Disclaimers next to the notice which
|
|
states that this License applies to the Document. These Warranty
|
|
Disclaimers are considered to be included by reference in this
|
|
License, but only as regards disclaiming warranties: any other
|
|
implication that these Warranty Disclaimers may have is void and has
|
|
no effect on the meaning of this License.
|
|
|
|
@item
|
|
VERBATIM COPYING
|
|
|
|
You may copy and distribute the Document in any medium, either
|
|
commercially or noncommercially, provided that this License, the
|
|
copyright notices, and the license notice saying this License applies
|
|
to the Document are reproduced in all copies, and that you add no other
|
|
conditions whatsoever to those of this License. You may not use
|
|
technical measures to obstruct or control the reading or further
|
|
copying of the copies you make or distribute. However, you may accept
|
|
compensation in exchange for copies. If you distribute a large enough
|
|
number of copies you must also follow the conditions in section 3.
|
|
|
|
You may also lend copies, under the same conditions stated above, and
|
|
you may publicly display copies.
|
|
|
|
@item
|
|
COPYING IN QUANTITY
|
|
|
|
If you publish printed copies (or copies in media that commonly have
|
|
printed covers) of the Document, numbering more than 100, and the
|
|
Document's license notice requires Cover Texts, you must enclose the
|
|
copies in covers that carry, clearly and legibly, all these Cover
|
|
Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on
|
|
the back cover. Both covers must also clearly and legibly identify
|
|
you as the publisher of these copies. The front cover must present
|
|
the full title with all words of the title equally prominent and
|
|
visible. You may add other material on the covers in addition.
|
|
Copying with changes limited to the covers, as long as they preserve
|
|
the title of the Document and satisfy these conditions, can be treated
|
|
as verbatim copying in other respects.
|
|
|
|
If the required texts for either cover are too voluminous to fit
|
|
legibly, you should put the first ones listed (as many as fit
|
|
reasonably) on the actual cover, and continue the rest onto adjacent
|
|
pages.
|
|
|
|
If you publish or distribute Opaque copies of the Document numbering
|
|
more than 100, you must either include a machine-readable Transparent
|
|
copy along with each Opaque copy, or state in or with each Opaque copy
|
|
a computer-network location from which the general network-using
|
|
public has access to download using public-standard network protocols
|
|
a complete Transparent copy of the Document, free of added material.
|
|
If you use the latter option, you must take reasonably prudent steps,
|
|
when you begin distribution of Opaque copies in quantity, to ensure
|
|
that this Transparent copy will remain thus accessible at the stated
|
|
location until at least one year after the last time you distribute an
|
|
Opaque copy (directly or through your agents or retailers) of that
|
|
edition to the public.
|
|
|
|
It is requested, but not required, that you contact the authors of the
|
|
Document well before redistributing any large number of copies, to give
|
|
them a chance to provide you with an updated version of the Document.
|
|
|
|
@item
|
|
MODIFICATIONS
|
|
|
|
You may copy and distribute a Modified Version of the Document under
|
|
the conditions of sections 2 and 3 above, provided that you release
|
|
the Modified Version under precisely this License, with the Modified
|
|
Version filling the role of the Document, thus licensing distribution
|
|
and modification of the Modified Version to whoever possesses a copy
|
|
of it. In addition, you must do these things in the Modified Version:
|
|
|
|
@enumerate A
|
|
@item
|
|
Use in the Title Page (and on the covers, if any) a title distinct
|
|
from that of the Document, and from those of previous versions
|
|
(which should, if there were any, be listed in the History section
|
|
of the Document). You may use the same title as a previous version
|
|
if the original publisher of that version gives permission.
|
|
|
|
@item
|
|
List on the Title Page, as authors, one or more persons or entities
|
|
responsible for authorship of the modifications in the Modified
|
|
Version, together with at least five of the principal authors of the
|
|
Document (all of its principal authors, if it has fewer than five),
|
|
unless they release you from this requirement.
|
|
|
|
@item
|
|
State on the Title page the name of the publisher of the
|
|
Modified Version, as the publisher.
|
|
|
|
@item
|
|
Preserve all the copyright notices of the Document.
|
|
|
|
@item
|
|
Add an appropriate copyright notice for your modifications
|
|
adjacent to the other copyright notices.
|
|
|
|
@item
|
|
Include, immediately after the copyright notices, a license notice
|
|
giving the public permission to use the Modified Version under the
|
|
terms of this License, in the form shown in the Addendum below.
|
|
|
|
@item
|
|
Preserve in that license notice the full lists of Invariant Sections
|
|
and required Cover Texts given in the Document's license notice.
|
|
|
|
@item
|
|
Include an unaltered copy of this License.
|
|
|
|
@item
|
|
Preserve the section Entitled ``History'', Preserve its Title, and add
|
|
to it an item stating at least the title, year, new authors, and
|
|
publisher of the Modified Version as given on the Title Page. If
|
|
there is no section Entitled ``History'' in the Document, create one
|
|
stating the title, year, authors, and publisher of the Document as
|
|
given on its Title Page, then add an item describing the Modified
|
|
Version as stated in the previous sentence.
|
|
|
|
@item
|
|
Preserve the network location, if any, given in the Document for
|
|
public access to a Transparent copy of the Document, and likewise
|
|
the network locations given in the Document for previous versions
|
|
it was based on. These may be placed in the ``History'' section.
|
|
You may omit a network location for a work that was published at
|
|
least four years before the Document itself, or if the original
|
|
publisher of the version it refers to gives permission.
|
|
|
|
@item
|
|
For any section Entitled ``Acknowledgements'' or ``Dedications'', Preserve
|
|
the Title of the section, and preserve in the section all the
|
|
substance and tone of each of the contributor acknowledgements and/or
|
|
dedications given therein.
|
|
|
|
@item
|
|
Preserve all the Invariant Sections of the Document,
|
|
unaltered in their text and in their titles. Section numbers
|
|
or the equivalent are not considered part of the section titles.
|
|
|
|
@item
|
|
Delete any section Entitled ``Endorsements''. Such a section
|
|
may not be included in the Modified Version.
|
|
|
|
@item
|
|
Do not retitle any existing section to be Entitled ``Endorsements'' or
|
|
to conflict in title with any Invariant Section.
|
|
|
|
@item
|
|
Preserve any Warranty Disclaimers.
|
|
@end enumerate
|
|
|
|
If the Modified Version includes new front-matter sections or
|
|
appendices that qualify as Secondary Sections and contain no material
|
|
copied from the Document, you may at your option designate some or all
|
|
of these sections as invariant. To do this, add their titles to the
|
|
list of Invariant Sections in the Modified Version's license notice.
|
|
These titles must be distinct from any other section titles.
|
|
|
|
You may add a section Entitled ``Endorsements'', provided it contains
|
|
nothing but endorsements of your Modified Version by various
|
|
parties---for example, statements of peer review or that the text has
|
|
been approved by an organization as the authoritative definition of a
|
|
standard.
|
|
|
|
You may add a passage of up to five words as a Front-Cover Text, and a
|
|
passage of up to 25 words as a Back-Cover Text, to the end of the list
|
|
of Cover Texts in the Modified Version. Only one passage of
|
|
Front-Cover Text and one of Back-Cover Text may be added by (or
|
|
through arrangements made by) any one entity. If the Document already
|
|
includes a cover text for the same cover, previously added by you or
|
|
by arrangement made by the same entity you are acting on behalf of,
|
|
you may not add another; but you may replace the old one, on explicit
|
|
permission from the previous publisher that added the old one.
|
|
|
|
The author(s) and publisher(s) of the Document do not by this License
|
|
give permission to use their names for publicity for or to assert or
|
|
imply endorsement of any Modified Version.
|
|
|
|
@item
|
|
COMBINING DOCUMENTS
|
|
|
|
You may combine the Document with other documents released under this
|
|
License, under the terms defined in section 4 above for modified
|
|
versions, provided that you include in the combination all of the
|
|
Invariant Sections of all of the original documents, unmodified, and
|
|
list them all as Invariant Sections of your combined work in its
|
|
license notice, and that you preserve all their Warranty Disclaimers.
|
|
|
|
The combined work need only contain one copy of this License, and
|
|
multiple identical Invariant Sections may be replaced with a single
|
|
copy. If there are multiple Invariant Sections with the same name but
|
|
different contents, make the title of each such section unique by
|
|
adding at the end of it, in parentheses, the name of the original
|
|
author or publisher of that section if known, or else a unique number.
|
|
Make the same adjustment to the section titles in the list of
|
|
Invariant Sections in the license notice of the combined work.
|
|
|
|
In the combination, you must combine any sections Entitled ``History''
|
|
in the various original documents, forming one section Entitled
|
|
``History''; likewise combine any sections Entitled ``Acknowledgements'',
|
|
and any sections Entitled ``Dedications''. You must delete all
|
|
sections Entitled ``Endorsements.''
|
|
|
|
@item
|
|
COLLECTIONS OF DOCUMENTS
|
|
|
|
You may make a collection consisting of the Document and other documents
|
|
released under this License, and replace the individual copies of this
|
|
License in the various documents with a single copy that is included in
|
|
the collection, provided that you follow the rules of this License for
|
|
verbatim copying of each of the documents in all other respects.
|
|
|
|
You may extract a single document from such a collection, and distribute
|
|
it individually under this License, provided you insert a copy of this
|
|
License into the extracted document, and follow this License in all
|
|
other respects regarding verbatim copying of that document.
|
|
|
|
@item
|
|
AGGREGATION WITH INDEPENDENT WORKS
|
|
|
|
A compilation of the Document or its derivatives with other separate
|
|
and independent documents or works, in or on a volume of a storage or
|
|
distribution medium, is called an ``aggregate'' if the copyright
|
|
resulting from the compilation is not used to limit the legal rights
|
|
of the compilation's users beyond what the individual works permit.
|
|
When the Document is included in an aggregate, this License does not
|
|
apply to the other works in the aggregate which are not themselves
|
|
derivative works of the Document.
|
|
|
|
If the Cover Text requirement of section 3 is applicable to these
|
|
copies of the Document, then if the Document is less than one half of
|
|
the entire aggregate, the Document's Cover Texts may be placed on
|
|
covers that bracket the Document within the aggregate, or the
|
|
electronic equivalent of covers if the Document is in electronic form.
|
|
Otherwise they must appear on printed covers that bracket the whole
|
|
aggregate.
|
|
|
|
@item
|
|
TRANSLATION
|
|
|
|
Translation is considered a kind of modification, so you may
|
|
distribute translations of the Document under the terms of section 4.
|
|
Replacing Invariant Sections with translations requires special
|
|
permission from their copyright holders, but you may include
|
|
translations of some or all Invariant Sections in addition to the
|
|
original versions of these Invariant Sections. You may include a
|
|
translation of this License, and all the license notices in the
|
|
Document, and any Warranty Disclaimers, provided that you also include
|
|
the original English version of this License and the original versions
|
|
of those notices and disclaimers. In case of a disagreement between
|
|
the translation and the original version of this License or a notice
|
|
or disclaimer, the original version will prevail.
|
|
|
|
If a section in the Document is Entitled ``Acknowledgements'',
|
|
``Dedications'', or ``History'', the requirement (section 4) to Preserve
|
|
its Title (section 1) will typically require changing the actual
|
|
title.
|
|
|
|
@item
|
|
TERMINATION
|
|
|
|
You may not copy, modify, sublicense, or distribute the Document
|
|
except as expressly provided under this License. Any attempt
|
|
otherwise to copy, modify, sublicense, or distribute it is void, and
|
|
will automatically terminate your rights under this License.
|
|
|
|
However, if you cease all violation of this License, then your license
|
|
from a particular copyright holder is reinstated (a) provisionally,
|
|
unless and until the copyright holder explicitly and finally
|
|
terminates your license, and (b) permanently, if the copyright holder
|
|
fails to notify you of the violation by some reasonable means prior to
|
|
60 days after the cessation.
|
|
|
|
Moreover, your license from a particular copyright holder is
|
|
reinstated permanently if the copyright holder notifies you of the
|
|
violation by some reasonable means, this is the first time you have
|
|
received notice of violation of this License (for any work) from that
|
|
copyright holder, and you cure the violation prior to 30 days after
|
|
your receipt of the notice.
|
|
|
|
Termination of your rights under this section does not terminate the
|
|
licenses of parties who have received copies or rights from you under
|
|
this License. If your rights have been terminated and not permanently
|
|
reinstated, receipt of a copy of some or all of the same material does
|
|
not give you any rights to use it.
|
|
|
|
@item
|
|
FUTURE REVISIONS OF THIS LICENSE
|
|
|
|
The Free Software Foundation may publish new, revised versions
|
|
of the GNU Free Documentation License from time to time. Such new
|
|
versions will be similar in spirit to the present version, but may
|
|
differ in detail to address new problems or concerns. See
|
|
@uref{http://www.gnu.org/copyleft/}.
|
|
|
|
Each version of the License is given a distinguishing version number.
|
|
If the Document specifies that a particular numbered version of this
|
|
License ``or any later version'' applies to it, you have the option of
|
|
following the terms and conditions either of that specified version or
|
|
of any later version that has been published (not as a draft) by the
|
|
Free Software Foundation. If the Document does not specify a version
|
|
number of this License, you may choose any version ever published (not
|
|
as a draft) by the Free Software Foundation. If the Document
|
|
specifies that a proxy can decide which future versions of this
|
|
License can be used, that proxy's public statement of acceptance of a
|
|
version permanently authorizes you to choose that version for the
|
|
Document.
|
|
|
|
@item
|
|
RELICENSING
|
|
|
|
``Massive Multiauthor Collaboration Site'' (or ``MMC Site'') means any
|
|
World Wide Web server that publishes copyrightable works and also
|
|
provides prominent facilities for anybody to edit those works. A
|
|
public wiki that anybody can edit is an example of such a server. A
|
|
``Massive Multiauthor Collaboration'' (or ``MMC'') contained in the
|
|
site means any set of copyrightable works thus published on the MMC
|
|
site.
|
|
|
|
``CC-BY-SA'' means the Creative Commons Attribution-Share Alike 3.0
|
|
license published by Creative Commons Corporation, a not-for-profit
|
|
corporation with a principal place of business in San Francisco,
|
|
California, as well as future copyleft versions of that license
|
|
published by that same organization.
|
|
|
|
``Incorporate'' means to publish or republish a Document, in whole or
|
|
in part, as part of another Document.
|
|
|
|
An MMC is ``eligible for relicensing'' if it is licensed under this
|
|
License, and if all works that were first published under this License
|
|
somewhere other than this MMC, and subsequently incorporated in whole
|
|
or in part into the MMC, (1) had no cover texts or invariant sections,
|
|
and (2) were thus incorporated prior to November 1, 2008.
|
|
|
|
The operator of an MMC Site may republish an MMC contained in the site
|
|
under CC-BY-SA on the same site at any time before August 1, 2009,
|
|
provided the MMC is eligible for relicensing.
|
|
|
|
@end enumerate
|
|
|
|
@c fakenode --- for prepinfo
|
|
@unnumberedsec ADDENDUM: How to use this License for your documents
|
|
|
|
To use this License in a document you have written, include a copy of
|
|
the License in the document and put the following copyright and
|
|
license notices just after the title page:
|
|
|
|
@smallexample
|
|
@group
|
|
Copyright (C) @var{year} @var{your name}.
|
|
Permission is granted to copy, distribute and/or modify this document
|
|
under the terms of the GNU Free Documentation License, Version 1.3
|
|
or any later version published by the Free Software Foundation;
|
|
with no Invariant Sections, no Front-Cover Texts, and no Back-Cover
|
|
Texts. A copy of the license is included in the section entitled ``GNU
|
|
Free Documentation License''.
|
|
@end group
|
|
@end smallexample
|
|
|
|
If you have Invariant Sections, Front-Cover Texts and Back-Cover Texts,
|
|
replace the ``with@dots{}Texts.'' line with this:
|
|
|
|
@smallexample
|
|
@group
|
|
with the Invariant Sections being @var{list their titles}, with
|
|
the Front-Cover Texts being @var{list}, and with the Back-Cover Texts
|
|
being @var{list}.
|
|
@end group
|
|
@end smallexample
|
|
|
|
If you have Invariant Sections without Cover Texts, or some other
|
|
combination of the three, merge those two alternatives to suit the
|
|
situation.
|
|
|
|
If your document contains nontrivial examples of program code, we
|
|
recommend releasing these examples in parallel under your choice of
|
|
free software license, such as the GNU General Public License,
|
|
to permit their use in free software.
|
|
|
|
@c Local Variables:
|
|
@c ispell-local-pdict: "ispell-dict"
|
|
@c End:
|
|
|
|
|
|
@node Index, , GNU Free Documentation License, Top
|
|
@comment node-name, next, previous, up
|
|
|
|
@unnumbered Index
|
|
@printindex cp
|
|
@bye
|
|
|
|
Conventions:
|
|
1. Functions, built-in or otherwise, do have () after them.
|
|
2. Gawk built-in vars and functions are in @code. Also program vars and
|
|
functions.
|
|
3. HTTP method names are in @code.
|
|
4. Protocols such as echo, ftp, etc are in @samp.
|
|
5. URLs are in @url.
|
|
6. All RFCs are in the index. Put a space between `RFC' and the number.
|